Labshake search
Citations for Addgene :
1 - 50 of 1590 citations for 6 9 DIMETHOXY PHENAZINE 1 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... pCAG_MMP-9 – full length mouse (MMP-9) from pcDNA3.1_MMP-9-HA (Addgene #121172) cloned into pCAG vector ...
-
bioRxiv - Neuroscience 2020Quote: ... doxycycline-inducible pT-BclXL-miR-9/9*-124 (Addgene, 60857) and reverse tetracycline-controlled transactivator rtTA (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... between the age of P60 and P120 (n = 6) were injected with virally encoded Cre-dependent GCaMP in PFC (~300 nl, AAV2/9 flex GCaMP6f, Addgene) and Cre in LEC (140 nl at each site ...
-
bioRxiv - Molecular Biology 2024Quote: The HTLV-1 CA (Gag amino acids 132-349) was cloned into the 6×His SUMO bacterial expression plasmid (pHYRSF53, Addgene, Watertown, MA), with mutants created by using the Gibson assembly procedure ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV2/9 (Addgene #112865), or rAAV2-retro (Addgene #81070 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/9.syn.GCaMP7f (Addgene), AAV2/1.ef1a.fDIO.GCaMP6s (Janelia Vector Core) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/9.syn.GCaMP7f (Addgene), AAV1.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/9 (Addgene #112865), or pUCmini-iCAP-PHP.eB (Addgene #103005) ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/9 (Addgene #112865), pAAV-hSyn-Cre (Addgene #170367)61 ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV2/9 Helper (Addgene, #112867), and pAd-deltaF6 (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: ... 9 µg psPAX2 (Addgene #12260), and 12 µg pLKO.1 transfer vector using Lipofectamine 2000 (Cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... psPAX2 (Addgene 12260, 9 µg), the guide containing vector (pXPR_066 ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 nL of AAV2/9-hSyn-GCaMP6s (Addgene, titer ≥ 1×1013 vg/mL) was pressure injected into each ocular vitreous through a glass micropipette using a Nanoject (Drumond Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 9 μg pMD2.G (Addgene #12259) and 3 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Physiology 2023Quote: ... and 9 μg of psPAX2 (Addgene), 6 μg of psPAX2 (Addgene) ...
-
bioRxiv - Neuroscience 2023Quote: ... with GFP1-9::iRFP702 (Addgene #130125), mouseStoml3-GFP10::mCHERRY and mouseElkin1-GFP11::eBP2 plasmids using Fugene HD and following manufacturer’s instructions (Promega) ...
-
bioRxiv - Neuroscience 2021Quote: ... Four rats were injected into the right FC with 0.02 μL of AAV2/9-CaMKII-hChR2(E123A)-mCherry-WPRE.hGH (Catalog #AV-9-35506; Addgene plasmid #35506 ...
-
bioRxiv - Genetics 2022Quote: ... 9 µg psPax2 packaging plasmid (Addgene #12260), and 1 µg VSV-G envelope plasmid (Addgene #8454 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/9-GfaABC1D-GCaMP6f virus (Addgene #52925) was stereotaxically injected into the cortex 2 weeks before imaging ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1 and pLKO.5 were sourced from Addgene (#1864; a gift from David Sabatini 9) and Sigma-Aldrich (St ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2/9-FLEX-tdTomato (Addgene, #28306-AAV9). For chronic window implantation ...
-
bioRxiv - Neuroscience 2020Quote: Raphe and RTN neurons - AAV-9: pGP-AAV-syn-GCaMP6s-WPRE.4.641 at a titre of 1×1013 GC·ml- 1 (Addgene, Watertown, MA, USA);
-
bioRxiv - Neuroscience 2020Quote: pFL - AAV-9: pGP-AAV-syn-GCaMP6f-WPRE.24.693 at a titre of 1×1013 GC·ml-1 (Addgene, Watertown, MA, USA).
-
bioRxiv - Biochemistry 2020Quote: ... and for luciferase assays a ratio of 1:9:10 HA-Clover plasmid:pcDNA(-):HRE-Luciferase (Addgene #26731) was used (physiological expression levels) ...
-
bioRxiv - Neuroscience 2022Quote: ... versus a respective control virus AAV2/1-DIO-hSYN1-mCherry (Addgene # 50459; titer: 9 × 1012 gc/ml). To ablate PVNOT neurons ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 9 μg of psPAX2 packaging vectors (Addgene #12260) using polyethylenimine (Polysciences ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/9-Syn-DIO-EGFP (Addgene # 100043-AAV9). Assignment of AAV was counterbalanced for sex ...
-
bioRxiv - Neuroscience 2024Quote: ... serotype 9 (AAV9) expressing GCaMP6s (AAV9.CAG.GCaMP6s.WPRE.SV40, Addgene, USA) was injected subcutaneously in the nape of the neck of pups (P2-P6) ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Neuroscience 2022Quote: ... or rAAV2/9 encoding for NIR-GECO2 under control of the synthetic CAG promoter (0.5 × 1012 -1 × 1013 gc/ml; AddGene plasmid #159603 ...
-
bioRxiv - Cancer Biology 2021Quote: MEFs were seeded in 6-well plates and transfected for 6-8 h with 1 μg of plasmid 4XCLEAR-luciferase reporter (Addgene, 66800) and 0.1 ug of CMV-Renilla Luciferase (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... 9 µg of psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Microbiology 2019Quote: ... The sgRNA cassette from pgRNA-bacteria 9 (Addgene plasmid # 44251) was introduced into pSCrhaB2 by restriction cloning with EcoRI and HindIII (NEB ...
-
bioRxiv - Neuroscience 2022Quote: We obtained the AAV serotype 9 hSyn-Cre from Addgene (#105555 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV.9.Ef1A.fDIO.EYFP (control for optogenetics, 140 nl, Addgene, no55641), ssAAV.1.2.hSyn1.dFRT.hM4D(Gi).mCherry(rev).dFRT.WPRE.hGHp(A ...
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453 ...
-
bioRxiv - Neuroscience 2020Quote: Brainbow3.0 AAV-2/9 and AAV-PhP.EB were obtained from Addgene and University of Michigan vector core ...
-
bioRxiv - Neuroscience 2021Quote: The adenoassociated virus (AAV) pAAV2/9.CAG.FLEX.GCaMP6s.WPRE.SV40 was purchased from Addgene (Addgene viral prep #100842-AAV9 ...
-
bioRxiv - Molecular Biology 2019Quote: ... thermophilus LMD-9 generated in this study are available from Addgene. Protein and DNA sequences for all St1Cas9 ORFs are available as supplemental items (Excel file) ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mCherry-FilaminA-N-9 (Addgene #55047, gift from Michael Davidson), pCMV-mEmerald-Alpha-Actinin-19 (Addgene #53989 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene, 83896) at a concentration of 6+13 genome copies per ml (gc/ml) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV.9.FLEX.rev.ChR2(H134R).mCherry (optogenetics, 140 nl, Addgene, no. 18916), AAV.9.Ef1A.fDIO.EYFP (control for optogenetics ...
-
bioRxiv - Biochemistry 2019Quote: ... and pFLAG-SREBP2Nt (N-terminal transcriptionally active domain, amino acids 1-482) (Addgene, 26807) were used to transfect cells (HEK293) ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: ... and hAHRΔe8-9 sequences were cloned in a lentiviral plasmid (Addgene #52961) and subsequently to pcDNA3.1 vector with the In-fusion HD Eco-dry cloning (Takarabio) ...
-
bioRxiv - Cell Biology 2021Quote: ... We used TALENs targeting exon 9 of RBM20 (Addgene #108342 and #108343) to generate the RBM20 R636S Het iPSC line ...