Labshake search
Citations for Addgene :
1 - 50 of 2353 citations for 6β Fluoro 21 hydroxypregna 1 4 9 11 16 tetraene 3 20 dione 21 acetate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... or mRuby2 (Addgene #54768, (21), gifts from Michael Davidson ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 21 were obtained from Addgene (Addgene plasmid #80659 ...
-
bioRxiv - Microbiology 2022Quote: ... The target sequence for the ACE2 gene (5′-TGCTGCTCAGTCCACCATTG-3′) was designed using CRISPR direct (https://crispr.dbcls.jp) and cloned into plentiCRISPR plasmids (21) (Addgene plasmid #52961 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... was used for KmR template[21] and pKDsgRNA-trmI (Addgene plasmid # 89955 ...
-
bioRxiv - Bioengineering 2019Quote: ... or 21 days prior to transfection with C1V1tt (Addgene plasmid # 35497). The Fubi-CHR2-GFP is a plasmid that generates channel-rhodopsin2 which is sensitive to blue light and C1V1tt plasmid generates a red-shifted channel-rhodopsin that is sensitive to green light [24] ...
-
bioRxiv - Cancer Biology 2023Quote: PB-TRE3G-MYCN and XLone-GFP (21) were acquired from Addgene. Plasmid information is provided in Supplementary Table S1 ...
-
bioRxiv - Microbiology 2019Quote: ... pON.mCherry (21) which was a gift from Howard Shuman (Addgene plasmid # 84821), strain TP997 (40 ...
-
bioRxiv - Neuroscience 2021Quote: ... and pcDNA3.1::miniSOG2-T2A-H2B-EGFP 21 were purchased from Addgene (USA). pSP-CiVACHT::Kaede was purchased from Ciona intestinalis Transgenic line RESources (CITRES) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The IRES site was amplified by PCR from pInducer-21 (Addgene #46948). YAP5SA was amplified by PCR from Addgene #33093 ...
-
bioRxiv - Genomics 2022Quote: ... Each 15-cm2 plate was transfected with a total of 21 μg of plasmid DNA (1:2:1 ratio psPAX2-D64V:pLenti-STARR:pLAI-Env) [psPAX-D64V (Addgene #63586), and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The GFP reporter pTk-GFP-21 was constructed from pEF-GFP (Addgene #11154). The EF1a promoter was replaced by a SalI/ KpnI pTk promoter fragment ...
-
bioRxiv - Bioengineering 2020Quote: ... pTRIP-SFFV-EGFP-NLS was previously described 21 (a gift from Nicolas Manel; Addgene plasmid # 86677 ...
-
bioRxiv - Molecular Biology 2020Quote: The plasmid expressing eSpCas9(1.1)21 was a gift from Feng Zhang (Addgene plasmid #71814). The U6 promoter was replaced with a tRNA promoter22 to facilitate the expression of sgRNA guides ...
-
bioRxiv - Cancer Biology 2021Quote: ... or RUNX1ΔEx6 amplified from cDNA obtained from 293T cells and the pINDUCER-21-RUNX1 plasmid (Addgene plasmid #97043 ...
-
High-performance GPCR optogenetics based on molecular properties of animal opsins, MosOpn3 and LamPPbioRxiv - Biochemistry 2022Quote: ... The vector backbone containing SL1 and GFP was obtained by digestion of the plasmid [pEM1 = flp-21::LoxPStopLoxP::npr-1 SL2 GFP] (Addgene plasmid # 24033)65 with NotI and KpnI ...
-
bioRxiv - Neuroscience 2020Quote: ... the following 21-mer shRNA inserts were cloned separately in the pLKO.3G vector (Addgene plasmid #14748): scrambled shRNA (CCTAAGGTTAAGTCGCCCTCG) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... was used for KmR template[21] and pKDsgRNA-trmI (Addgene plasmid # 89955; http://n2t.net/addgene:89955; RRID:Addgene_89955) was used for the lambda red recombinase system[25] ...
-
bioRxiv - Genomics 2023Quote: ... 16 ug of plasmid were prepared for each plate at a ratio of 4:3:1 (sgRNA library: psPAX2(Addgene ID 12259): pMD2G(Addgene ID 12260)) ...
-
bioRxiv - Bioengineering 2020Quote: ... pTRIP-SFFV-EGFP-NLS was previously described 21 (a gift from Nicolas Manel; Addgene plasmid # 86677; http://n2t.net/addgene:86677; RRID:Addgene_86677). cDNA for human TMPRSS2 and Hygromycin resistance gene was obtained by synthesis (IDT) ...
-
bioRxiv - Neuroscience 2024Quote: ... to express channelrhodopsin (ChR2) or control virus (n = 4, AAV-Ef1a-fDIO-mCherry, 200 mL, 3 × 1012 GC/mL; Serotype: 9; Addgene) was unilaterally injected over 10 minutes into the MePD using a 2-µL Hamilton microsyringe (Esslab ...
-
bioRxiv - Neuroscience 2023Quote: ... a somatic targeting GtACR (AAV5-hSyn1-SIO-stGtACR1-FusionRed) 21 or ChR (AAV5-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA) were used (both Addgene). For long-term silencing a cre dependent TelC AAV (AAV5-hSyn-FLEX-TeLC-P2A-dTomato ...
-
bioRxiv - Microbiology 2022Quote: ... were introduced into a previously described spike-expression plasmid containing D614G and a 21-amino-acid deletion in the cytoplasmic tail (Addgene 158762) (34) ...
-
bioRxiv - Systems Biology 2020Quote: ... the cells were transfected with a mix of 8 μg lentiviral lentiCRISPRv2 vector containing the TKOv3 gRNA library 21 (Addgene #90294), 4.8 μg packaging vector psPAX2 ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells seeded to 150mm dishes were transfected with 21 μg of the human gRNA pooled library in lentiGuide-Puro (Addgene #1000000049), 15.75 μg of pSPAX2 and 5.25 μg of pVSV-G plasmids ...
-
bioRxiv - Bioengineering 2023Quote: CHO cells were electroporated with 2 μg of plasmids containing the primary or a fragment of the primary microRNA sequences of three miRs that were in high abundance in standard or stressed cultures (miR-21 (Addgene #21114), miR-92a (Addgene #46672) ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells (between passage 9-11) were transfected with lentiviral packaging vector psPAX2 (#12259, Addgene, Watertown, MA, USA), the envelope vector pMD2.G (#12260 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The Myr-RSK3 vector (pWZL Neo Myr Flag RPS6KA2) was a kind gift from William Hahn & Jean Zhao (Addgene plasmid # 20621; (21)).
-
bioRxiv - Bioengineering 2021Quote: HDM-SARS2-Spike-delta21 and HDM-SARS2-Spike-del21-614G encoding SARS-CoV-2 Spike with 21 amino acid C-terminal deletion for lentiviral pseudo-typing were purchased from Addgene (Watertown, MA) with serial numbers of Addgene #155130 and Addgene#158762 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or RUNX1ΔEx6 amplified from cDNA obtained from 293T cells and the pINDUCER-21-RUNX1 plasmid (Addgene plasmid #97043; http://n2t.net/addgene:97043; RRID:Addgene_97043 (Sugimura et al., 2017)) ...
-
bioRxiv - Genetics 2019Quote: ... 600 ng of the mutant SCN5A plasmid and 100 ng of a plasmid expressing Bxb1 recombinase (a gift from Pawel Pelczar,21 Addgene plasmid #51271). On day 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... and pSFFV_mNG2(11)1-10 (Addgene #82610), respectively ...
-
bioRxiv - Molecular Biology 2019Quote: ... 293T cells seeded onto 150mm dishes were transfected with 21 µg of the murine lenti-GeCKO-V2 plasmid library (Addgene pooled library #1000000053), 0.168 ng each of the sgRNAs targeting miR-15mut and miR-16-1mut ...
-
bioRxiv - Neuroscience 2023Quote: ... we used AAV2/9-pAAV-hDlx-hM3Dq-dTomato-Fishell-4 (Addgene, 83897) and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg pBABE-neo largeT antigen cDNA (Addgene, 1780 ref (16))using lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... pCAG_MMP-9 – full length mouse (MMP-9) from pcDNA3.1_MMP-9-HA (Addgene #121172) cloned into pCAG vector ...
-
bioRxiv - Plant Biology 2024Quote: ... for Level 1 and 3 and pEven1-4 (pCsA-E, Addgene plasmids # 136067-136070) for Level 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.3 μl of AAV2/9-CAG-ChR2-mCherry (3 × 1012 genomic copies per mL, Addgene, 100054) or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL ...
-
bioRxiv - Neuroscience 2020Quote: ... doxycycline-inducible pT-BclXL-miR-9/9*-124 (Addgene, 60857) and reverse tetracycline-controlled transactivator rtTA (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... 8-9 20 nL injections of AAV1-Syn-flex-GCaMP6s (Addgene #100845-AAV1, Chen et al., 2013) were delivered to the RSC (AP ...
-
bioRxiv - Cancer Biology 2023Quote: ... plasmids as described previously.11 pLKO.1-Scrambled plasmids (Addgene, #136035) were used as negative control ...
-
bioRxiv - Cell Biology 2020Quote: ... specifically: pETM-11 (AddGene) for Sar1 and pFASTBacHTb (AddGene ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV2/9 (Addgene #112865), or rAAV2-retro (Addgene #81070 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/9.syn.GCaMP7f (Addgene), AAV2/1.ef1a.fDIO.GCaMP6s (Janelia Vector Core) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/9.syn.GCaMP7f (Addgene), AAV1.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/9 (Addgene #112865), or pUCmini-iCAP-PHP.eB (Addgene #103005) ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/9 (Addgene #112865), pAAV-hSyn-Cre (Addgene #170367)61 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Immunology 2022Quote: ... et al 16 were purchased from Addgene (Supplemental Table 1), and used to make stable expression cell lines in HEK293 cells by lentiviral transduction ...
-
bioRxiv - Microbiology 2021Quote: ... 4-363h21C1 and 3-978h1C1 and were cloned into lentiviral vector pLKO.1-puro (Addgene, catalogue #8543). Lentiviral vectors were produced in 293T cells by Fugene transfection and the supernatant was used to infect Jurkat cells ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2/9 encoding jRGECO1a under control of the human synapsin promoter (4 × 1013 gc/ml; customized from AddGene plasmid #61563 ...