Labshake search
Citations for Addgene :
1 - 50 of 698 citations for 17 Hydroxyprogesterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... and 17 μg of plentiCas9-Blast (Addgene, Watertown, MA; #52962) by the calcium phosphate method ...
-
bioRxiv - Developmental Biology 2022Quote: The LARRY lentiviral barcoding library 17 was purchased from Addgene (https://www.addgene.org/pooled-library/camargo-plarry-egfp-barcoding-v1/) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ElonginC (17–112) and ElonginB (1–104) (Addgene ID 204500 & 204501) were co-expressed in E ...
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Each well was transfected with the PB-UniSAM plasmid (Addgene 99866 {Fidanza, 2017 #17}) containing either one of the four gRNAs against RUNX1C promoter {Fidanza ...
-
bioRxiv - Cell Biology 2022Quote: ... GCaMP6s-GTU construct was made based on mCherry-γ-Tubulin-17 backbone (Addgene #55050). GCaMP6s constructs were stably expressed in C2C12 cells to perform Ca2+ imaging ...
-
bioRxiv - Immunology 2021Quote: ... human embryonic kidney 293T/17 cells were transfected with pcDNA3.1(-)hACE2 (Addgene plasmid #1786). Transfection was performed in 293T/17 cells using the genejuice (Novagen ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Genetics 2022Quote: ... Guides were cloned into SpCas9-2A-GFP (pX458)17 plasmid (Addgene #48138, a gift of Feng Zhang). CRISPR guides used in this study are presented in Table S1 ...
-
bioRxiv - Molecular Biology 2022Quote: The sgRNAs of chromosome 15 and chromosome 17 were connected to the pX330-mCherry plasmid (Addgene, 98750). WT cells were transfected with 250□Jµl Opti-MEM that contained 5□Jµl Lipofectamine 2000 (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... 17 as a template and inserted into pXR002: EF1a-dCasRx-2A-EGFP (a gift from Patrick Hsu; Addgene plasmid #109050 ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T/17 cells were cotransfected with the respective transfer vector and second-generation lentiviral cassettes (packaging vector psPAX2 (Addgene RRID:Addgene_12260) and envelope vector pMD2.G (Addgene RRID:Addgene_12259) ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Cell Biology 2020Quote: We PCR amplified Ecad using pEGFP-N1-Ecad plasmid [46] and V5-TurboID using mutant BirA R118S (TurboID) (Addgene [17]) using PCR primers (Table S4) ...
-
bioRxiv - Cancer Biology 2022Quote: ... we transfected HEK 293T/17 cells with different plasmids together with the packaging plasmids pMD2.G (Gift from Didier Trono (Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T/17 cells were cotransfected with the respective transfer vector and second-generation lentiviral cassettes (packaging vector psPAX2 (Addgene RRID:Addgene_12260) and envelope vector pMD2.G (Addgene RRID:Addgene_12259) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the coding sequence of mNeonGreen was PCR-amplified from pAc5-V5::mNeonGreen [17] and ligated into the EcoRI-digested pQUAST (#24349, Addgene) vector using In-Fusion ...
-
bioRxiv - Genetics 2021Quote: ... Stable integration of a WT SCN5A into LP-cells was achieved using an optimized SB transposon system (17) using the pSBbi-GN plasmid (a gift from Eric Kowarz, Addgene #60517), which contains SB transposon sequences for genomic integration flanking a promoter upstream of GFP and a second promoter upstream of a multiple cloning site (MCS ...
-
bioRxiv - Cell Biology 2019Quote: ... 11.3 ug of each half library was co-transfected with 17 ug of psPAX2 (Addgene #12260, a gift from Didier Trono) and 11.3 ug of pCMV-VSV-G (addgene #8454 ...
-
bioRxiv - Cancer Biology 2024Quote: High-titre lentiviral supernatants were produced by transient transfection of 293T/17 cells with second-generation packaging/envelope vectors pRRE (Addgene #12251), pREV (Addgene #115989) ...
-
bioRxiv - Genomics 2022Quote: Lentiviral particles were produced by transfecting 293T-17 cells (ATCC: CRL-11268) with the envelope construct pCMV-VSV-G (Addgene plasmid 8454), the packaging construct pCMV-dR8.2 dvpr (Addgene plasmid 8455) ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Conditional knockout cells were generated by infection with media from a confluent 10 cm dish of 293T cells transfected with 3 µg pCL-Eco (Addgene, 12371 ref (17)) and 3 µg MSCV CreERT2 puro (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Genetics 2020Quote: Barcoded MSH2-2A-blR cDNA libraries were packaged into lentivirus by co-transfecting HEK293T/17 cells (ATCC) with the transfer plasmid pool plus envelope and packaging vectors (pMD2.G, Addgene #12259 and psPAX2, #12260). For each pool ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2-retro-CMV-bGlo-iCre-GFP (made in house; 1.07×1012 GC ml-1; 17) and AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362; 4.6×1012 GC ml-1; 19); chemogenetic non-projection specific inhibition experiments AAV8-hSyn-hM4D(Gi)-mCherry (Addgene #50475 ...
-
bioRxiv - Neuroscience 2019Quote: ... forward primer-5’-AGCAGCACGACTTCTTCAAGTCC and reverse primer 5’-TGTAGTTGTACTCCAGCTTGTGC (modified protocol from Addgene, USA). A known concentration (2 × 109 molecules/µl ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg p8.9NdeltaSB (Addgene #132929) and 0.5 μg pCMV-VSV-G (Addgene #8454) ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Cell Biology 2021Quote: ... and AAV packaging plasmid expressing Rep2/Cap5 genes for production of serotype 5 – pAAV2/5 (RRID:Addgene_104964).
-
bioRxiv - Neuroscience 2024Quote: ... we obtained the AAV2/5 virus of the GFAP -tdTomato vector from Addgene (#44332-AAV2/5). Titers ranged from 1-4 x 1013 vg/mL.
-
bioRxiv - Plant Biology 2022Quote: ... pICH41402 (Addgene #50285; ΩTMV 5’UTR), pAGM47523 (Addgene #153221 ...
-
bioRxiv - Biophysics 2022Quote: ATG12–5-16L1-GFP constructs (Addgene_169077) were expressed and purified from SF9 cells as described25 (dx.doi.org/10.17504/protocols.io.br6qm9dw) ...
-
bioRxiv - Immunology 2019Quote: ... pCMV-DR8.2 (5 ng, Addgene #12263) and 2.5 μg of the lentiviral vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of VSV.G (#14888, Addgene) and 5 μg pCL-Eco (#12371 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/5.EF1a-eYFP.WPRE.hGH (Addgene, titer ≥ 7×10¹2 vg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 μg pMD2G (12259; Addgene) using Lipofectamine 2000 according to the manufacturer’s instructions ...