Labshake search
Citations for Addgene :
1 - 50 of 1524 citations for 17 Hydroxyprogesterone ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ElonginC (17–112) and ElonginB (1–104) (Addgene ID 204500 & 204501) were co-expressed in E ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 17 μg of plentiCas9-Blast (Addgene, Watertown, MA; #52962) by the calcium phosphate method ...
-
bioRxiv - Developmental Biology 2022Quote: The LARRY lentiviral barcoding library 17 was purchased from Addgene (https://www.addgene.org/pooled-library/camargo-plarry-egfp-barcoding-v1/) ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2-retro-CMV-bGlo-iCre-GFP (made in house; 1.07×1012 GC ml-1; 17) and AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362; 4.6×1012 GC ml-1; 19); chemogenetic non-projection specific inhibition experiments AAV8-hSyn-hM4D(Gi)-mCherry (Addgene #50475 ...
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Each well was transfected with the PB-UniSAM plasmid (Addgene 99866 {Fidanza, 2017 #17}) containing either one of the four gRNAs against RUNX1C promoter {Fidanza ...
-
bioRxiv - Cell Biology 2022Quote: ... GCaMP6s-GTU construct was made based on mCherry-γ-Tubulin-17 backbone (Addgene #55050). GCaMP6s constructs were stably expressed in C2C12 cells to perform Ca2+ imaging ...
-
bioRxiv - Immunology 2021Quote: ... human embryonic kidney 293T/17 cells were transfected with pcDNA3.1(-)hACE2 (Addgene plasmid #1786). Transfection was performed in 293T/17 cells using the genejuice (Novagen ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Genetics 2022Quote: ... Guides were cloned into SpCas9-2A-GFP (pX458)17 plasmid (Addgene #48138, a gift of Feng Zhang). CRISPR guides used in this study are presented in Table S1 ...
-
bioRxiv - Molecular Biology 2022Quote: The sgRNAs of chromosome 15 and chromosome 17 were connected to the pX330-mCherry plasmid (Addgene, 98750). WT cells were transfected with 250□Jµl Opti-MEM that contained 5□Jµl Lipofectamine 2000 (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... 17 as a template and inserted into pXR002: EF1a-dCasRx-2A-EGFP (a gift from Patrick Hsu; Addgene plasmid #109050 ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T/17 cells were cotransfected with the respective transfer vector and second-generation lentiviral cassettes (packaging vector psPAX2 (Addgene RRID:Addgene_12260) and envelope vector pMD2.G (Addgene RRID:Addgene_12259) ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Cell Biology 2020Quote: We PCR amplified Ecad using pEGFP-N1-Ecad plasmid [46] and V5-TurboID using mutant BirA R118S (TurboID) (Addgene [17]) using PCR primers (Table S4) ...
-
bioRxiv - Cancer Biology 2022Quote: ... we transfected HEK 293T/17 cells with different plasmids together with the packaging plasmids pMD2.G (Gift from Didier Trono (Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T/17 cells were cotransfected with the respective transfer vector and second-generation lentiviral cassettes (packaging vector psPAX2 (Addgene RRID:Addgene_12260) and envelope vector pMD2.G (Addgene RRID:Addgene_12259) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the coding sequence of mNeonGreen was PCR-amplified from pAc5-V5::mNeonGreen [17] and ligated into the EcoRI-digested pQUAST (#24349, Addgene) vector using In-Fusion ...
-
bioRxiv - Genetics 2021Quote: ... Stable integration of a WT SCN5A into LP-cells was achieved using an optimized SB transposon system (17) using the pSBbi-GN plasmid (a gift from Eric Kowarz, Addgene #60517), which contains SB transposon sequences for genomic integration flanking a promoter upstream of GFP and a second promoter upstream of a multiple cloning site (MCS ...
-
bioRxiv - Cell Biology 2019Quote: ... 11.3 ug of each half library was co-transfected with 17 ug of psPAX2 (Addgene #12260, a gift from Didier Trono) and 11.3 ug of pCMV-VSV-G (addgene #8454 ...
-
bioRxiv - Cancer Biology 2024Quote: High-titre lentiviral supernatants were produced by transient transfection of 293T/17 cells with second-generation packaging/envelope vectors pRRE (Addgene #12251), pREV (Addgene #115989) ...
-
bioRxiv - Genomics 2022Quote: Lentiviral particles were produced by transfecting 293T-17 cells (ATCC: CRL-11268) with the envelope construct pCMV-VSV-G (Addgene plasmid 8454), the packaging construct pCMV-dR8.2 dvpr (Addgene plasmid 8455) ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Molecular Biology 2022Quote: ... Conditional knockout cells were generated by infection with media from a confluent 10 cm dish of 293T cells transfected with 3 µg pCL-Eco (Addgene, 12371 ref (17)) and 3 µg MSCV CreERT2 puro (Addgene ...
-
bioRxiv - Genetics 2020Quote: Barcoded MSH2-2A-blR cDNA libraries were packaged into lentivirus by co-transfecting HEK293T/17 cells (ATCC) with the transfer plasmid pool plus envelope and packaging vectors (pMD2.G, Addgene #12259 and psPAX2, #12260). For each pool ...
-
bioRxiv - Microbiology 2023Quote: 4e5 VeroE6 cells were plated in 6-well plates and transfected with 1 μg VSV-G plasmid (Addgene #8454) via TransIT-X2 (Mirus) ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: MEFs were seeded in 6-well plates and transfected for 6-8 h with 1 μg of plasmid 4XCLEAR-luciferase reporter (Addgene, 66800) and 0.1 ug of CMV-Renilla Luciferase (Promega ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 packaging plasmid (Addgene 12260), 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... control or mir-218-1-overexpressing HTR8 cells were seeded into 12-well plates and were co-transfected with 1 µg/mL of 5X NFκB luciferase reporter (64) (Addgene plasmid #12453) construct and 20 ng/mL of Renilla luciferase vector (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... MEFs were split into 6 well plates to ∼80% confluence and transfected with 2 µg SV40 1: pBSSVD2005 (a gift from David Ron; Addgene plasmid #21826) using FuGENE HD according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... 16 ug of plasmid were prepared for each plate at a ratio of 4:3:1 (sgRNA library: psPAX2(Addgene ID 12259): pMD2G(Addgene ID 12260)) ...
-
bioRxiv - Neuroscience 2022Quote: ... we cloned the dgn-1 promoter and AcNPV p10 3’UTR into the vector pPD49.26 (from the Andrew Fire plasmid kit, Addgene Kit #1000000001) to generate plasmid pNTC2 ...
-
bioRxiv - Neuroscience 2021Quote: ... or KH1*KH2* mutants were PCR amplified from their respective pAc5.1B-EGFP vector and cloned into the HindIII and EcoRI sites of the pAc5.1-lambdaN-HA vector (a gift from Elisa Izaurralde; Addgene plasmid #21302) (Behm-Ansmant et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... was PCR amplified and cloned downstream of EGFP in the pAc5.1B-EGFP vector (a gift from Elisa Izaurralde; Addgene plasmid #21181) using the HindIII and EcoRI restriction sites to make pAcB5.1-EGFP-FMRP ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The YTK kit (Addgene; Kit #1000000061) was used as a source for all relevant non-coding DNA sequences — including promoters and terminators ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MoClo Plant Parts Kit (Addgene Kit #1000000047), GreenGate Cloning System (Addgene Kit #1000000036 ...
-
bioRxiv - Genetics 2021Quote: ... TALE modules were picked from glycerol stocks of module library plates (Addgene 1000000034), incubated overnight at 37°C in L-broth containing 50 ng/μL ampicillin and DNA isolated using the QIAprep Spin Miniprep kit (Qiagen 27104 ...
-
bioRxiv - Neuroscience 2021Quote: ... For each plate were used 30μg of pAdDeltaF6 helper plasmid (Addgene plasmid # 112867), 15μg of pAAV2-8 Rep-Cap plasmid (Addgene plasmid # 112864) ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected overnight in 10cm plates with N-GFP-RelA (Addgene #23255) or C-Flag-Rela (Addgene #20012 ...
-
bioRxiv - Immunology 2024Quote: ... grown in wells of 6-well plates with 1000 ng psPAX2 (Addgene plasmid #12260) packaging plasmid ...
-
bioRxiv - Systems Biology 2022Quote: ... and lambda phosphatase were purchased from Addgene (Addgene Kit #1000000094)7.
-
bioRxiv - Neuroscience 2021Quote: ... MEFs were then expanded to 6-well plates and transiently transfected with SV40T antigen (Addgene) and maintained until stably proliferative ...
-
bioRxiv - Genomics 2022Quote: ... elegans Vector Kit was a gift from Andrew Fire (Addgene kit # 1000000001). A translational reporter was later generated by synthesizing the remainder of the coding sequence (IDT ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.25 μL of F-ABM lentiviral mix (1:1:1:1 of Addgene plasmids 27150 ...