Labshake search
Citations for Addgene :
201 - 250 of 748 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... The 1208 bp rab-3 promoter sequence (Addgene Plasmid #110880) was inserted directly upstream of the N-terminal TOMM-20 coding region ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 μg pMD2.G (gift from Didier Trono, Addgene #12259), 12 μg of pCMV delta R8.2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2022Quote: ... were generated by annealing two primers ordered from IDT DNA and cloned using BbsI into pKSB-sgRNA (Addgene #173671—3) vectors containing the U6 snRNA polymerase III promoter (AGAP013557) ...
-
MYB68 orchestrates cork differentiation by regulating stem cell proliferation and suberin depositionbioRxiv - Plant Biology 2024Quote: ... and 3) the P336-FBP_11 vector (Available from AddGene (#139702)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TGFBR2 (5’-ccttgtagacctcggcgaag-3’) cloned into LentiCRISPRv2 puro (Addgene) (20) ...
-
bioRxiv - Cancer Biology 2023Quote: Toronto Knockout Version 3 library was purchased from Addgene (#90294) (26) ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Cancer Biology 2024Quote: ... or shRNAs against YAP (5’-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGGATGTCAGAACTCAAAGCTTTTTTTC -3’, cat. 27368, Addgene, pLKO1-shYAP1 was a gift from Kunliang Guan ...
-
bioRxiv - Genetics 2024Quote: ... gfp and unc-54 3’UTR from pPD95.75 (Addgene #1494) using primers P29 and P30 ...
-
bioRxiv - Biophysics 2019Quote: ... ZapA-LPETG was incubated with 0.5 mM of labelled peptide GGGC-Cy5 and 10μM Sortase 7M (purified using pET30b-7M SrtA, a gift from Hidde Ploegh, Addgene plasmid #51141) in a final concentration of 50 μM ...
-
bioRxiv - Plant Biology 2021Quote: ... vector was modified to tie resistance marker gene expression directly to Cas9-Nlux expression by the P2A peptide linker to generate the plasmid pNOC-ARS-CRISPR-P2A-BlastR (Addgene: 98147). The P2A-BlastR fragment was amplified from pNOC-ARS-destiny-P2A-BlastR-GFP (Poliner et al. ...
-
bioRxiv - Bioengineering 2020Quote: ... The ScFv library with the N-terminal CD8α signal peptide was fused to the synNotch-Gal4VP64 receptor backbone (Addgene plasmid #79125) in place of the CD19-specific scFv ...
-
bioRxiv - Immunology 2019Quote: ... The PresentER plasmid encoding a signal peptide from Mouse Mammary Tumor Virus envelope protein followed by the SIINFEKL epitope followed by mCherry was obtained from Addgene (#102945),a kind gift of D ...
-
bioRxiv - Synthetic Biology 2020Quote: The Sav library was created based on a previously described expression plasmid that contains a T7-tagged Sav gene with an N-terminal ompA signal peptide for export to the periplasm under control of the T7 promoter in a pET30b vector (Addgene #138589)34 ...
-
bioRxiv - Cell Biology 2021Quote: ... the cytosolic domain of Miro1 (Miro1(ΔTM)) and the iLID binding peptide (SspB, obtained from Addgene #60415, gift from B. Kuhlman) were fused into pmCherry-C1 using EcoRI and KpnI ...
-
bioRxiv - Bioengineering 2023Quote: ... The AAV capsid AAV1-X1 was built by inserting a 7-mer peptide between AAs 588-589 of the AAV1 cap gene in AAV1-Rep-Cap (Challis et al. 2019) (Addgene 112862).
-
bioRxiv - Cell Biology 2023Quote: A synthetic sequence corresponding to 2A peptide from Thoseaasigna virus capsid protein and BspTI (AflII) restriction site was first cloned to pCXLE-EGFP (Plasmid #27082, Addgene, www.addgene.org) (Okita et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′-TTCAGGGCACAGCCTAGAAC -3′ and 5′-GATTCT-GCCCTAGCCCCACC -3′) into the pX458 vector (Addgene Plasmid #48138 (Ran et al. 2013)) ...
-
bioRxiv - Cell Biology 2020Quote: ... we generated derivatives of pCFD5:U6:3-t::gRNA (Addgene, #73914). A first derivative (pCFD5:U6:3-t::gRNA_pst-1 ...
-
bioRxiv - Genetics 2021Quote: Calu-3 cells were transduced with lenti Cas9-Blast (Addgene #52962), or with lenti dCAS-VP64_Blast (Addgene #61425) ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Cancer Biology 2021Quote: pcDNA3.1-Myoferlin-HA and peGFP-hGalectin-3 was purchased from Addgene (plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected 3×100 nl AAV5.Ef1a.DIO.eYFP (Penn Core, Addgene: 27056) into the mPFC (AP/ML/DV coordinates 2.2 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) were gifts from Benjamin H ...
-
bioRxiv - Genetics 2023Quote: ... pCFD4-U6:1_U6:3 was a gift from Simon Bullock (Addgene plasmid #49411 ...
-
bioRxiv - Plant Biology 2023Quote: ... a C-terminal 3×FLAG® epitope tag (pICSL50007; Addgene #50308), and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST ...
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276 ...
-
bioRxiv - Biochemistry 2023Quote: The plasmid used to express Cas1 and Cas2/3 (Addgene #89240) was PCR amplified with mutagenic primer pairs using Q5 polymerase (NEB ...
-
bioRxiv - Genetics 2024Quote: ... along with 3 µg of pMXs.hOct4 (Octamer-Binding Protein 4, RRID:Addgene_17217), pMXs.hSox2 (SRY-Box Transcription Factor 2 ...
-
bioRxiv - Biochemistry 2022Quote: Plasmids encoding the full-length spike proteins with native signal peptides were cloned into the background of the HDM-SARS2-Spike-delta21 plasmid (Addgene Plasmid #155130). This construct contains a 21 amino acid c-terminal deletion to promote viral expression ...
-
bioRxiv - Immunology 2022Quote: The 21-amino acid C-terminally truncated spike proteins with native signal peptides were cloned in place of the HDM-SARS2-spike-delta21 gene (Addgene plasmid, 155130). This construct contains a 21-amino acid C-terminal deletion to promote viral production ...
-
bioRxiv - Biochemistry 2023Quote: The 21-amino acid C-terminally truncated spike proteins with native signal peptides were cloned in place of the HDM-SARS2-spike-delta21 gene (Addgene plasmid, 155130). This construct contains a 21-amino acid C-terminal deletion to promote viral production ...
-
bioRxiv - Cell Biology 2020Quote: ... an sgRNA (5’-TTGGCACGCCTCCTCAGGCA-3’) was sub-cloned into PX458 (Addgene, 48138). The C-terminal region of the CENP-E gene was amplified with the following primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... or exon 3 of TET3 and cloned into pX330 vector (Addgene #42230) as previously described 47 ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3 µg of the pX-EGFP-g1 expression plasmid (Addgene plasmid #107273)28 was transfected into 1.0 × 106 gene-targeted patient iPSCs ...
-
bioRxiv - Molecular Biology 2019Quote: ... and RPA 2 and 3 were cloned into 11A vectors (Addgene: 48294), followed by assembly of all RPA subunits into one vector by successive ligation independent cloning reactions ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-CaMKIIa-eGFP (titer ≥ 3×1012 vg/mL, Addgene, catalog # 50469-AAV5) and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL ...
-
bioRxiv - Neuroscience 2019Quote: ... which were inserted into pDD162 (Peft-3::Cas9 + Empty sgRNA; Addgene #47549), respectively ...
-
bioRxiv - Biochemistry 2021Quote: pCDEF3-hTIM-3 was a gift from Lawrence Kane (Addgene plasmid # 49212), and contained the natural variant L119 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg pBABE-neo largeT antigen cDNA (Addgene, 1780 ref (16))using lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Developmental Biology 2020Quote: ... The injection mix contained: 60 ng/µl Peft-3::Cas9 (Addgene #46168), 15 ng/µl repair template ...
-
bioRxiv - Biochemistry 2020Quote: pHA#851: osm-10p∷Fynempty∷unc-54 3’UTR (Addgene ID: 139208)
-
bioRxiv - Biochemistry 2020Quote: pHA#853: mec-4p∷Fynempty∷unc-54 3’UTR (Addgene ID: 139210)
-
bioRxiv - Biochemistry 2020Quote: pHA#850: osm-10p∷FynY531F∷unc-54 3’UTR (Addgene ID: 139207)
-
bioRxiv - Cancer Biology 2022Quote: ... 3×106 HEK293T cells were transfected with 2.25 µg psPAX2 (Addgene, 12260), 1.5 µg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... DCX DNA was cloned into the N-Terminal pFLAG 3 vector (Addgene) by restriction digest using NotI and BamHI restriction enzymes ...
-
bioRxiv - Neuroscience 2022Quote: ... for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml, Addgene) for neuronal Ca2+ detection was mixed with the astrocyte-targeted CalEx encoding construct AAV2/5.GfaABC1D-HA-hPMCA2w/b (1.18 × 1013 gc/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... or RB1 (5’-GCTCTGGGTCCTCCTCAGGA-3’) were cloned into the lentiCRISPRv2 (Addgene #52961) plasmid ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The pRPC-oscillator plasmid is based on pZS1-lTlrLLtCL [3] (Addgene #26489) with the dCas9 gene taken from pdCas9-bacteria [18] (Addgene #44249) ...