Labshake search
Citations for Addgene :
1401 - 1450 of 2564 citations for 5 Oxo 5 3 oxo 3 4 dihydro 2H quinoxalin 1 yl pentanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... or a 1:1 combination of GCaMP6f+hM4Di-mCherry (same as used for behavior, AAV8-CaMKIIa-hM4Di-mCherry, Addgene).
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 2-mTFP1 (or dynamin 1-mTFP1) construct was created by replacing the EGFP tag of dynamin 2-EGFP (or dynamin 1-EGFP, Addgene) with mTFP1 (Addgene) ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLenti CMV rtTA3 Hygro (w785-1) used for creating tetracycline-inducible cell lines were gifts from Eric Campeau (w762-1: Addgene plasmid #26434 ...
-
bioRxiv - Genomics 2020Quote: ... Plasmids for human LINE-1 expression: pBS-L1PA1-CH-mneo (CMV-LINE-1) was a gift from Astrid Roy-Engel (Addgene plasmid # 51288 ...
-
bioRxiv - Cancer Biology 2021Quote: ... For loss of function studies, pLKO.1 puro and pLKO.1 shCDH1 (Onder et al., 2008) were purchased from Addgene. pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120 ...
-
bioRxiv - Cell Biology 2022Quote: ... gBlock 1 encoding N-terminus Calponin domains (CH-CH) of giant Nesprin 1 was cloned into Spectrin-cpstFRET (plasmid#61109, Addgene) cut with AgeI and ScaI renstriction enzymes (New England Biosciences) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Cell Biology 2019Quote: ... The short isoform of human NEAT-1 lncRNA (hNEAT-1 v1) was amplified from the plasmid pCRII_TOPO_hNEAT1 (a gift from Archa Fox, Addgene plasmid 61518) and incorporated into an AgeI/BamHI digested pmax-ponA backbone vector ...
-
bioRxiv - Microbiology 2020Quote: ... pmTurquiose2-Golgi (Beta-1,4-galactosyltransferase 1 1-61 Aa) in red is to show the Golgi apparatus (Addgene cat 36205) (27) ...
-
bioRxiv - Physiology 2019Quote: ... annealed and cloned into pLKO.1 at EcoRI and AgeI restriction sites as per the pLKO.1 protocol from Addgene. The resultant plasmids were transformed in DH5α cells for amplification and isolated ...
-
bioRxiv - Immunology 2020Quote: ... and the full-length protein (IFT20, aa 1-132) in-frame with the tags into the pEGFP-N1 (#6085-1 Addgene) and pGEX-6P-2 vectors (#27-4598-01Addgene) ...
-
bioRxiv - Bioengineering 2022Quote: ... Each shRNA was cloned into the host pLKO.1-puro vector. PLKO-shFOXA1#1 (Cat. #: 70095) and PLKO-shFOXA1#2 (Cat. #: 70096) were obtained from Addgene, and previously used 45 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... with 0.5 µg of either a 1:1 mixture of the S plasmids and a Jun-Nt Venus fragment (Addgene 22012) plasmid or a mixture of hACE2 plasmid (kindly provided by Dr ...
-
bioRxiv - Biochemistry 2024Quote: ... The Venus-PDZ1 (ZO-1) was generated by site directed mutagenesis of the Venus-ZO-1 expression vector (Addgene: 56394) using primer pairs that delete the entire ZO-1 coding sequence except for the first PDZ1 domain ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment encoding the T-cell-restricted intracellular antigen-1 (TIA-1) was digested from pFRT-TO-eGFP-TIA1 (#106094, Addgene) using Bsp1407I (TaKaRa ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
bioRxiv - Neuroscience 2023Quote: ... we used a 1:1 combination of AAV8-CaMKIIα-GFP-Cre (UNC) and AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Cat. #44362, Addgene).
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-Ef1a-mCherry-IRES-Cre (1×1013 vg/ml #55632) and AAV2-CMV-EGFP (1×1013 vg/ml, #105530) were purchased from Addgene.
-
bioRxiv - Neuroscience 2021Quote: ... The pLKO.1-TRC cloning vector (RRID: Addgene_10878) and the pLKO.1-sh-Ctl (RRID ...
-
bioRxiv - Neuroscience 2021Quote: ... and the pLKO.1-sh-Ctl (RRID: Addgene_10879) were kindly provided by Marian Martínez-Balbás ...
-
bioRxiv - Cell Biology 2021Quote: ... to either pLKO.1 puro (Addgene Plasmid #8453) for constitutive knockdown or Tet-pLKO-puro (Addgene Plasmid #21915 ...
-
bioRxiv - Genetics 2021Quote: ... and 1 μg CMV-SB10 (Addgene plasmid # 24551) via the tail vein in 5-7 s ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 μg pCAGGS-mCherry (Addgene, plasmid #41583) (45) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Using 1 ng pCFD6 (Addgene, Cat. No: 73915) as template ...
-
bioRxiv - Biophysics 2019Quote: ... and human KIF1A (aa 1-393; Addgene # 61665). Tau-2N4R ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1 μL of LSL-tdTomato (Addgene#: 100048); 2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmid pIRES2-eGFP (Addgene, Cat#6029-1) was used as transfection control ...
-
bioRxiv - Neuroscience 2020Quote: ... and pCAFNF-tdTomato (Addgene#125575, 1 μg/μL) were used ...
-
bioRxiv - Microbiology 2020Quote: ... and pcDNA3.1-V5-hMcl-1 (Addgene plasmid #25375) were purchased from Addgene (Cambridge ...
-
bioRxiv - Genomics 2021Quote: ... and 1 µg of pMD2.G (Addgene, 12259) lentivirus packaging plasmids into 8 million HEK293T cells in a 10-cm dish with PolyJet (SignaGen Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1 μg pMD2.G (Addgene plasmid, 12259) combined with the overexpression vectors H2B-cherry ...
-
bioRxiv - Cell Biology 2022Quote: ... together with 1 μg pVSV-G (#138479, Addgene) and 2 μg psPAX2 (#12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... HSV-1 UL12.5 was purchased from Addgene (#70109) and the EGFP was removed by subcloning ...
-
bioRxiv - Immunology 2022Quote: ... then ligated into pLKO.1 vector (Addgene #10878) using AgeI/EcoRI ...
-
bioRxiv - Microbiology 2022Quote: ... and pLVX or pLKO.1 transfer plasmids (Addgene) using jetOPTIMUS according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we inserted shRNA sequences into pLKO.1 (Addgene) or shmirRNA (Addgene ...
-
bioRxiv - Genetics 2024Quote: ... mixed with 1 μg of PsPax2 (Addgene # 12260), 1 μg of the lentiviral transfer vector G1088E_pLenti-CMV-mNeonGreen-2A-HygroR (Addgene #216279) ...
-
bioRxiv - Cell Biology 2023Quote: ... KIF5C(1-560)-2xmCh-EF(C) (Addgene #61664) and KIF5C(1-560)-mCit (Addgene #61676 ...
-
bioRxiv - Genetics 2023Quote: ... anti-Na/K-ATPase (1:1000, Addgene #180089) (membrane protein loading control) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviral cloning vector pLKO.1-TRC (Addgene, #10878) was used for shRNA expression ...
-
bioRxiv - Genomics 2023Quote: ... and 1 μg of pMD2.G (Addgene, 12259) packaging plasmids were cotransfected into 8 million HEK293T cells in a 10-cm dish supplemented with 36 μl PolyJet (SignaGen Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used human decipher module 1 library (RRID:Addgene_28289)(Diehl et al ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9 ...
-
bioRxiv - Cell Biology 2023Quote: ... For lentiviral transfections 1 μg VSVG (Addgene #8454) and 1.86 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2024Quote: ... and the pLKO.1 plasmid (Addgene, Cambridge, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV.Ef1a.DIO.EYFP (Addgene #27056-AAV5, 1×1012 vg/ml) was used as a control virus for the optogenetic real time place preference task ...
-
bioRxiv - Cell Biology 2024Quote: ... plKO.1-TetON-Puro-Hif1a 0819 (Addgene 118704).
-
bioRxiv - Cancer Biology 2024Quote: ... pLenti CMV rtTA3 Hygro (w785-1) (Addgene: 26730), pCW57.1-4EBP1_4xAla (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... was mixed 1:1 with the retrogradely trafficked AAV encoding eGFP (AAVrg-hsyn-EGFP, 7.4 × 1012 vg/mL; Addgene, Watertown, MA) and infused into the BLA (AP ...