Labshake search
Citations for Addgene :
951 - 1000 of 1928 citations for 7 Chloro 3 nitro 3 4 dihydro 1H quinolin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: Plasmids used in this study include mEmerald-Mito-7 (a gift from Dr. Michael Davidson (Addgene plasmid # 54160; http://n2t.net/addgene:54160; RRID:Addgene_54160)) ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml; Addgene viral prep # 50465-AAV1; http://n2t.net/addgene:50465; RRID:Addgene_50465) were injected into the dorsolateral (100-200 nl ...
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54148 ; http://n2t.net/addgene:54148 ; RRID:Addgene 54148) For protein depletion ...
-
bioRxiv - Molecular Biology 2022Quote: ... using primer 1008F and 1007R and cloning it into AgeI and FseI sites of pLdCH (Addgene #84291, (7)) ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmids used in this study were as follows: YFP-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56596 ; http://n2t.net/addgene:56596 ; RRID:Addgene_56596), EGFP-DCX was a gift from Joseph Gleeson (Addgene plasmid # 32852 ...
-
bioRxiv - Neuroscience 2023Quote: ... The CMV::tdTomato-Lifeact-7 plasmid (abbreviated Lifeact throughout the manuscript) was a gift from Michael Davidson (Addgene plasmid # 54528 ...
-
bioRxiv - Neuroscience 2023Quote: ... mKeima-Red-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56018; http://n2t.net/addgene:56018; RRID:Addgene_56018) Transfections have been performed with Lipofectamin 3000 (Thermofisher ...
-
bioRxiv - Biophysics 2023Quote: ... The pT7-7 aSyn C141 plasmid was a gift from Gabriele Kaminski Schierle (Addgene plasmid #108866; RRID: Addgene_108866). After lysis with boiling ...
-
bioRxiv - Developmental Biology 2023Quote: ... TdTomato-LifeAct tdTomato-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54528 ; http://n2t.net/addgene:54528 ; RRID:Addgene_54528). Primers for all subcloned constructs are shown in Supplementary Table 8 ...
-
bioRxiv - Biochemistry 2023Quote: The pT7-7 α-syn WT plasmid (a gift from Hilal Lashuel, Addgene, Watertown, NY, United States (61)) ...
-
bioRxiv - Biophysics 2023Quote: ... The pT7-7 aSyn C141 plasmid was a gift from Gabriele Kaminski Schierle (Addgene plasmid #108866; RRID: Addgene_108866). After lysis with boiling ...
-
bioRxiv - Neuroscience 2024Quote: ... An intersectional approach was used for selective activation of mPFC to BLA projection using chemogenetics: 1) retrograde AAV encoding FlpO (0.3 μL, titer ≥ 7 x 1012 GC/ml, Addgene# 55637; RRID:Addgene_55637) were bilaterally injected into BLA (A-P ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/2 (Addgene 104963), adenovirus helper plasmid pAdDeltaF6 (Addgene 112867 ...
-
bioRxiv - Microbiology 2020Quote: ... The plentiCRISPRV.2 (Addgene) was digested with BsmBI and ligated with guide RNA sequences specific for IFNAR1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/2 (Addgene #104963), pAAV2/5 (Addgene #104964) ...
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... psPAX-2 (Addgene #12260) was used as a packaging plasmid ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were reprogrammed by a mixture of retroviral vectors encoding OCT3/4 (pMXs-hOCT3/4 Addgene: 17217), SOX2 (pMXs-hSOX2 Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLE-hOCT3/4-shp53-F (Addgene plasmid #27077 ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 μg psPAX2 packing plasmid (Addgene, 12260), and 0.8 μg pMD2.G envelope plasmid (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLS-hOCT3/4 (Addgene plasmid #27076) episomal vectors (Okita et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of psPAX2 (Addgene plasmid # 12260), and 2 μg of pMD2.G plasmid (Addgene plasmid # 12259 ...
-
bioRxiv - Microbiology 2020Quote: ... 4 µg hCas9 D10A (Addgene plasmid #41816) (Mali et al. ...
-
bioRxiv - Genetics 2019Quote: ... 4 μg of pMD2.G plasmid (Addgene), and 8 μg of psPAX2 (Addgene ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Insulin in pX330S-4 (Plasmid #58780, Addgene) and Glut2 in pX330S-5 (Plasmid #58781 ...
-
bioRxiv - Cell Biology 2019Quote: ... Lamin A-mEmerald (mEmerald-LaminA-N-18) and NLS-mCherry (mCherry-Nucleus-7) were gifts from Michael Davidson (Addgene plasmids #54139 and #55110 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Neuroscience 2021Quote: ... over V1 using an ultrafine dental drill and inserted a glass pipette backfilled with AAV2.1-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (titer: 7×1012 vg/mL, 20298-AAV1 Addgene). In total 50 nL was injected in V1 (bilateral binocular V1 for Task A and unilateral V1 for Task B ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAVrg-hSyn-DIO-hM3D(Gq)-mCherry (titer >7×1012 vg/ml, viral prep #44361-AAVrg, Addgene, US,68). For canine adenovirus (CAV ...
-
bioRxiv - Biophysics 2019Quote: ... This α-actinin1-SNAP-His fragment was introduced downstream of the T7 promoter of pET T7-7 plasmid (Addgene).
-
bioRxiv - Biochemistry 2021Quote: The guide RNA sequence CAGAATTGGCGCTATGCTAC targeting exon 7 of FUT8 was cloned into px458 pSpCas9(BB)-2A-GFP (Addgene). The resulting plasmid was transfected into Huh7 cells using ViaFect (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... AAVrg-CAG-GFP (titer ≥ 7×1012vg/mL, category number 37825, lot V9234) was purchased from Addgene (Watertown, MA, USA).
-
bioRxiv - Bioengineering 2022Quote: ... To generate H2B-iRFP lentiviral particles HEK 293T cells were plated in a 6-well plate (7×105 cells per well) and transiently transfected with 1.5 μg of pLenti-pGK-DEST-H2B-iRFP vector (Addgene # 90237 ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmids used in this study were as follows: YFP-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56596 ...
-
bioRxiv - Neuroscience 2023Quote: Adult mice were stereotaxically injected at 7-10 weeks of age with 600 nl of 1.5×1013 vg/ml AAV1-CKIIa-stGtACR2-FusionRed (AddGene) or 7×1012 vg/ml AAV1-CKIIa-mCherry control at bilateral ACC (antero-posterior (AP ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... experimental animals received bilateral infusions (0.5 µL/hemisphere) of AAV5-hSyn-DIO-hM3D(Gq)-mCherry (7×1012 vg/mL; Addgene) into the VTA as described in [32] ...
-
bioRxiv - Developmental Biology 2023Quote: Full length fmi cDNA from UAS-fmi (ref 7) was subcloned in two EcoR1-Xho1fragments into pQUAST (#24349; Addgene) and transformed into w1118 flies to generate random genomic insertions.
-
bioRxiv - Neuroscience 2024Quote: ... Each eye was injected with 1μL of AAV2-Ef1a-fDIO-mCherry (7×10¹² vg/mL; Addgene, Catalog #: 114471-AAV2) using a custom Hamilton syringe (Borghuis Instruments ...
-
bioRxiv - Cancer Biology 2024Quote: ... All sgRNAs used for validation (Supplementary Table 7) were cloned into the pLenti-sgRNA(lib)-puro vector (Addgene, #119976) through Golden Gate assembly ...
-
bioRxiv - Neuroscience 2020Quote: ... In one C57BL/6 animal each we used AAV5-Syn-GCaMP6s or AAVrg-Syn-jGCaMP7f (Addgene, USA) with similar results to those obtained with GCaMP6f (Supplementary Fig ...
-
bioRxiv - Neuroscience 2024Quote: 120 000 iPS cells were plated on 12-well plates one day before the transduction by lentiviruses pLV_TRET_hNgn2_UBC_Puro (Addgene: 61474) and pLV_hEF1a-rtTA3 (Addgene:61472 ...
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were injected with one of two control viruses: AAV9-hSyn-DIO-mCherry (AddGene Plasmid #50459), virus titer 2.17 x 1013 or AAV9-hSyn.HI.eGFP-Cre-WPRE-SV40 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537; pEJS1096: Dual-sgRNA:Design 1, Addgene # 159538). Oligonucleotides with spacer sequences for target genes were inserted into the sgRNA cassette by ligation into the BspQI and BsmBI cloning sites.
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537 ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636; http://n2t.net/addgene:36046; RRID:Addgene_36046) and pT7-7 α-Syn A53T (Addgene plasmid #10572737 ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 µL of 4.6 x 1012vg/mL AAV5-hSyn-DIO-hM4D(Gi)-mCherry (UNC Viral Vector Core; (Krashes et al., 2011)) or 7 x 1012vg/mL AAV5-hSyn-DIO-mCherry (Addgene) was injected at 2.1 mm below the surface of the brain (Andrews-Zwilling et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... CRF1-cre mice were injected with 500 nL/hemisphere of AAV5-hSyn-DIO-eGFP (50457-AAV5; titer ≥ 7×10¹² vg/mL, Addgene) into the VTA (ML ±0.60 ...
-
bioRxiv - Neuroscience 2024Quote: ... A 603 bp long nucleotide encoding for cystatin-7 was cloned into the BamHI/EcoRI sites of pAAV-hSyn-EGFP (# 50465, Addgene) to receive the plasmid pAAV-hSyn-Cst7 ...
-
bioRxiv - Neuroscience 2024Quote: ... animals were injected bilaterally in the mPFC with an anterograde Cre-dependent AAV5-hSyn-DOI-hM3Dq-mCherry (7×10¹² vg/mL, plasmid #44361, Addgene) for RHA rats (hM3Dq-group ...
-
bioRxiv - Neuroscience 2022Quote: ... titer ≥ 7× 1012 vg/mL; gift from Edward Boyden and purchased through UNC Vector Core; now commercially available from Addgene viral preparation #37825-AAV5 ...