Labshake search
Citations for Addgene :
901 - 950 of 1893 citations for Human Cytochrome P450 Family 4 Subfamily F Member 2 CYP4F2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 2 μg pMD2.G envelope plasmid (plasmid #12259; Addgene, Teddington, UK), and 12 μg of the pLJM1 vector for overexpression (plasmid #19319 ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 µL plasmid DNA (ERmoxGFP43, Addgene Cat. # 68072, 420 ng/µL), and 96 µL of PBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bcl-2 proteins and their mutants (pMIG-Bcl-xL from Addgene, pMIG-BCL2 [6] ...
-
bioRxiv - Genetics 2020Quote: ... Lentiviral particles were generated in 293T cells using pMDG.2 (Addgene) and psPAX2 (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
bioRxiv - Developmental Biology 2022Quote: The Capture sequence 2 was added to the gRNA_Purp_Backbone (Addgene #73797) by PCR ...
-
bioRxiv - Neuroscience 2022Quote: [2] piggyBac backbone from pBAC-ECFP-15xQUAS_TATA-SV40 (Addgene, ID #104875) (Riabinina et al. ...
-
bioRxiv - Microbiology 2024Quote: ... pcDNA3.1-Ha-Dynamin 2.K44A (gift of S. Schmid, Addgene 34685), pEGFPC1 (Clontech) ...
-
bioRxiv - Microbiology 2024Quote: ... pEGFP-Dynamin 2.K44A (gift of P. De Camilli; Addgene 22301), and pEGFP-Dynamin 2ΔPRD (50 ...
-
bioRxiv - Neuroscience 2024Quote: ... driven by synapsin promoter (Addgene, 100843-AAV9, 2×109 vg/coverslip) (20) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg of plasmid expressing CRISPR-Cas9 and guide (Addgene #42230) and 40 pmol ssDNA repair template were transfected using Lipofectamine 3000 (Invitrogen L3000001 ...
-
bioRxiv - Cell Biology 2024Quote: The Capture sequence 2 was added to the gRNA_Puro_Backbone (Addgene #73797) by PCR ...
-
bioRxiv - Microbiology 2023Quote: ... and cloned into UC Berkeley Macrolab vector 2-CT (Addgene #29706), which encodes an N-terminal TEV protease cleavable His6-MBP (maltose binding protein ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... and the sgRNA was ligated into pX330A-1×2 (Addgene, 58766). To construct donor vector ...
-
bioRxiv - Genomics 2022Quote: ... and pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP (Addgene 84151) with slight modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... and pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915). The integration orientation of yellow progenies from MiMIC injection and 3xP3-GFP-progenies from CRIMIC injection were confirmed by PCR genotyping ...
-
bioRxiv - Systems Biology 2023Quote: ... Each promoter was then cloned into the pMW#2 (Addgene #13349) and pMW#3 (Addgene #13350 ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mg VSV-G Env expression vector pMD2.G (Addgene #12259) and 2 mg Gag-Pol expression vector psPAX2 (Addgene #12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951; http://n2t.net/addgene:154951; RRID:Addgene_154951)32 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509; http://n2t.net/addgene:51509; RRID:Addgene_51509)55.
-
bioRxiv - Cell Biology 2024Quote: ... and marker pCFJ90 (Pmyo-2-mCherry; Addgene #19327, 2.5 ng/µL) was injected into N2 young adult hermaphrodites ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1000 ng frame selector (pCAS9-mCherry-Frame +0/+1/+2, Addgene plasmid #66939/#66940/#66941 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pDONR207 SARS-CoV-2 nsp1 R124A/K125A (M2, Addgene #164523) plasmids using the primers 5-EX-NSP1 and 3-NB-NSP1 and cloned into pEGFP-N1 digested with EcoRI and NotI enzymes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pRSV-Rev (at a ratio of 4:1:1:1, Addgene#12259, #12251, #12253)41 into HEK293T cells ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml) was a gift from Lin Tian (Addgene viral prep #111068-AAV5 ...
-
bioRxiv - Neuroscience 2019Quote: ... oligonucleotide pairs (Supplementary Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Neuroscience 2022Quote: ... (4) P10-3’UTR was amplified from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene 36432); (5 ...
-
bioRxiv - Neuroscience 2020Quote: ... DIV 4 neurons were transfected with pGP-CMV-GCaMP6f (a gift from Douglas Kim, Addgene plasmid # 40755 ...
-
bioRxiv - Synthetic Biology 2019Quote: We modified the vector pX330A_dCas9–1 × 4 (a gift from Takashi Yamamoto, Addgene plasmid #63598) by inserting a gBlock Gene Fragment (Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgFIGNL1#4: CCTATACCCAAGCAAGATGG) were cloned into lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) in a single-step digestion-ligation reaction (2 hours (h ...
-
bioRxiv - Neuroscience 2022Quote: [4] DsRed from pBac-DsRed-ORCO_9kbProm-QF2 (a gift from Christopher Potter, Addgene ID #104877) (Riabinina et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 x 105 cells from the previous transfection were transfected with pCMV-PEmax (Addgene: 174820)11 (800 ng ...
-
bioRxiv - Cancer Biology 2023Quote: SUDHL-4 cell line was infected using pLKO.1-puro-GFP U6 sgRNA (Addgene #50920) containing BAX RNA guides or non-targeting RNA guide:
-
bioRxiv - Neuroscience 2024Quote: ... oligonucleotide pairs (Supplemental Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Cancer Biology 2021Quote: Cas9-expressing stable cell lines were produced by infection with the lentivirus encoding human codon-optimized Streptococcus pyogenes Cas9 protein (LentiV_Cas9_puro, Addgene plasmid # 108100) and subsequent selection with 1 μg/mL puromycin ...
-
bioRxiv - Immunology 2021Quote: ... The human full length (HFL) gene sequence was subcloned from pcDNA5/FRT/TO HIS HSPA1A (a gift from Harm Kampinga, Addgene plasmid # 19537 ...
-
bioRxiv - Neuroscience 2021Quote: ... were infused bilaterally with AAV expressing the inhibitory designer receptor human M4 muscarinic receptor (hM4Di; AAV8-hSyn-hM4Di-mCherry, 4.8 × 1012 or 3.7 × 1012 vg/mL; Addgene; 0.3 μL) at a rate of 0.1 μL/min into the mOFC (AP ...
-
bioRxiv - Biochemistry 2022Quote: ... was made by ligating a PCR fragment encoding full-length human protein between ApaI and BamHI sites of pHis10-PS-SNAPf (75) (gift from Ron Vale; Addgene plasmid #78512 ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-CAGCGGAGCCCAGTAGATTC-3’ (exon19) (Raaijmakers et al., 2018) were cloned into the human codon optimised SpCas9 and chimeric guide expression plasmid (pX330, Addgene) using BbsI as previously described (Ran et al. ...
-
bioRxiv - Biophysics 2019Quote: Expression of N-terminally acetylated human αS and βS proteins was performed via co-expression with pNatB plasmid (Addgene #53613) in E ...
-
bioRxiv - Cell Biology 2020Quote: ... pLV-pEF1α-mNeonGreenPXN was generated by cloning of a sequence encoding human paxillin (PXN) from pmCherry Paxillin (a gift from Kenneth Yamada, Addgene plasmid #50526 ...
-
bioRxiv - Cell Biology 2021Quote: ... Source of different elements are as follows: LAMP1 signal peptide and human LAMP1 were PCR amplified from LAMP1-mGFP (Addgene Plasmid #34831 ...
-
bioRxiv - Biochemistry 2020Quote: ... and FMRP was purchased as a gene block from IDT. The human sequence (not optimized for E. coli) for FXR1P was purchased from Addgene. The genes coding for the human fragile X proteins (FMRP isoform 1 NCBI Reference Sequence ...
-
bioRxiv - Bioengineering 2020Quote: ... and mRuby2-tagged Lifeact were constructed by inserting the PCR-amplified cDNAs (human TAGLN2, pFN21ASDA0120, Kazusa DNA Research Institute; Lifeact, Addgene plasmid # 54688 ...
-
bioRxiv - Neuroscience 2021Quote: ... The GCaMP6s reporter was expressed in neurons under the human synapsin promoter following successful AAV transduction (AAV1-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA, AddGene). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: HEK-293T cells were transfected with the human PSD4 containing pLV lentivirus (VB160428-1095xdp – Vector Builder) together with the 3rd generation lentiviral packaging plasmid (Addgene): pMDLG/pRRE (Gag and Pol) ...
-
bioRxiv - Cancer Biology 2019Quote: Lentiviruses were prepared in human embryonic kidney 293T cells (ATCC) by triple transfection of the viral vector with psPAX2 + pMD.2G (Addgene) and transduced into MCF10A-5E ...
-
bioRxiv - Neuroscience 2020Quote: ... P5-7 WT C57Bl/6 mice were used for the injection of AAV9 virus under human synapsin promoter (pAAV9.hSyn.iGluSnFR, commercially available from Addgene, USA) to drive transgenic expression of iGluSnFR in SGNs ...
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... CACCGGATCGGCCAGAGTTACTCC; Reverse primer: AAACCGGAGTAACTCTGGCCGATCC) and human STIM1 (Forward primer: CACCGTGAGGATAAGCTCATCAGCG; Reverse Primer: AAACCGCTGATGAGCTTATCCTCAC) genes were subcloned into pLentiguide puro (Addgene). sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1 ...
-
bioRxiv - Genomics 2020Quote: ... Plasmids for human LINE-1 expression: pBS-L1PA1-CH-mneo (CMV-LINE-1) was a gift from Astrid Roy-Engel (Addgene plasmid # 51288 ...