Labshake search
Citations for Addgene :
901 - 950 of 1928 citations for 7 Chloro 3 nitro 3 4 dihydro 1H quinolin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... RLAs received AAV5-hSyn-DOI-hM4D(Gi)-mCherry (7×10¹²vg/mL, Addgene, plasmid number 44362). As a control ...
-
bioRxiv - Immunology 2024Quote: ... HEK293T cells were transfected with the lentiviral vector pScalps-EGFP-Cre recombinase (7) (Addgene plasmid 207132) together with the packaging vectors psPAX2 and pMD2.G (Addgene plasmids 12260 and 12259 by Didier Trono ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... TG+ controls received identical bilateral infusions of AAV5-hSyn-DIO-mCherry (7×1012 vg / mL; Addgene) and TG-controls received sterile saline.
-
bioRxiv - Neuroscience 2023Quote: ... The virus carried either a red calcium indicator alone (7 mice; jRGECO1a; AAV1.Syn.NES.jRGECO1a.WPRE.SV40; a gift from Douglas Kim & GENIE Project (Addgene plasmid # 100854 ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected a Cre-dependent AAV (AAV5-syn-FLEX-jGCaMP7f-WPRE (Addgene: 7×1012 vg/ml)) in the zona incerta of Vgat-cre mice (Jax 028862 ...
-
bioRxiv - Neuroscience 2024Quote: ... and AAVretrograde-jRGECO1a (7×1012) (pAAV.Syn.NES-jRGECO1a.WPRE.SV40 was a gift from Douglas Kim & GENIE Project (Addgene viral prep # 100854-AAVrg ...
-
bioRxiv - Neuroscience 2024Quote: ... we injected a Cre-dependent AAV (AAV5-syn-FLEX-jGCaMP7f-WPRE (Addgene: 7×1012 vg/ml)) in the NAc of Vgat-cre mice (Jax 028862 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of PHGDH plasmid or 4 μg of empty vector plasmid (Addgene, plasmid #52107) was mixed with 4 μg of DNA RV helper plasmid (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... n=2) or AAV9.EF1a.dflox.hChR2(H134R).EYFP.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2, n=2). Subject mice were additionally injected in vCA2 (AP −3.0 ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Cancer Biology 2022Quote: ... These plasmids are based on all-in-one pSpCas9(BB)-2A-Puro (px459) (Addgene #62988) V2.0 and pSpCas9n(BB)-2A-Puro (px462 ...
-
bioRxiv - Biochemistry 2023Quote: ... we constructed a constitutive all-in-one dead SaCas9 (dSaCas9) system from construct (Addgene #164563) via Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... using a similar all-in-one lentivirus that did not express GFP (pLIX-403; Addgene_41395), and were made monoclonal via single-cell sorting to ensure comparable inducible expression of UNK in cells within a population and among populations expressing Flag-HA-tagged UNKWT ...
-
bioRxiv - Cell Biology 2024Quote: ... Both sgRNAs were cloned into an all-in-one vector encoding Cas9 D10A nickase (Addgene) with puromycin as a selection marker ...
-
bioRxiv - Cell Biology 2022Quote: ... mCardinal-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54663 ; http://n2t.net/addgene:54663 ; RRID:Addgene_54663). Vectashield antifade mounting medium (Vectorlabs ...
-
bioRxiv - Neuroscience 2019Quote: Mice 5-7 weeks old received bilateral microinfusion of AAV1-CamKiia-hChR2(H134R)-mCherry.WPRE.hGH (Addgene, #26975-AAV1) layer 2/3 of the barrel cortex (−1.3mmAP ...
-
bioRxiv - Cell Biology 2022Quote: ... The mCh-NLS plasmid was generated by Michael Davidson and obtained from Addgene (mCh-Nucleus-7, #55110). The pericentrin-RFP plasmid (Gillingham & Munro ...
-
bioRxiv - Cancer Biology 2022Quote: ... mEmerald-Rab11a-7 was a gift from Michael Davidson (Addgene plasmid #54245; http://n2t.net/addgene:54245; RRID:Addgene_54245). pTag-RFP-C-h-Rab11a-c-Myc was a gift from James Johnson (Addgene plasmid #79806 ...
-
bioRxiv - Neuroscience 2020Quote: The alrm-QF2 line was generated by subcloning the enhancer region into pPTQF#7-hsp70 (Addgene# 46136) using EcoRI and BamHI ...
-
bioRxiv - Neuroscience 2020Quote: ... A cohort of SOM.iPKR and PKCδ.iPKR mice were injected with bilaterally in CeL with 200 nl of AAV.Eef1a1 Pr.DIO.EGFPL10a (7 × 10^^12 GC/ml, Addgene) for immunohistochemistry experiment; ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 nl of AAVretro-EF1a-mCherry-IRES-Flpo obtained from Addgene (titer, 7 x 10e12 vg/mL) was unilaterally injected in the basal forebrain (0.25 mm AP ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-Nucleus-7 plasmid was generated by Michael Davidson and obtained from Addgene (Addgene plasmid no. 55110). Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry-Rab5a-7 was a gift from Michael Davidson (Addgene plasmid # 55126; http://n2t.net/addgene:55126; RRID:Addgene_55126) PH-Btk-GFP was a gift from Tamas Balla (Addgene plasmid # 51463 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The GFP1-10 and GFP11×7 fragments were obtained from plasmids pcDNA3.1-GFP(1-10) (Addgene: 70219) and pACUH-GFP11×7-mCherry-α-tubulin (Addgene ...
-
bioRxiv - Biophysics 2020Quote: ... The sequence was then excised with XbaI and HindIII and inserted into pT7-7 plasmid (Addgene #36046) between the XbaI and HindIII restriction sites to generate a plasmid template construct (pT7-fastFISH (pT7-fF)).
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-Rab7a-7 was a gift from Michael Davidson (Addgene plasmid #55127; http://n2t.net/addgene:55127; RRID:Addgene_55127). Lamp1-RFP62 was a gift from Walther Mothes (Addgene plasmid # 1817 ...
-
bioRxiv - Neuroscience 2022Quote: mRuby-Mito-7 was a gift from Michael Davidson (Addgene plasmid #55874; http://n2t.net/addgene:55874; RRID:Addgene_55874). mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860 ...
-
bioRxiv - Neuroscience 2024Quote: ... 7 Chrna2-Crewt/wt) were injected bilaterally with 300 nl of AAV9-hSyn-DIO-hM3Dq-mCherry (Addgene, LOT 44361-AAV9 ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml; Addgene viral prep # 50465-AAV1 ...
-
bioRxiv - Biophysics 2023Quote: ... EGFP-Vimentin-7 was a gift from Michael Davidson (Addgene plasmid #56439; http://n2t.net/addgene:56439; RRID:Addgene_56439).
-
bioRxiv - Cell Biology 2024Quote: ... and 7 µg pMD2.G (gift from Didier Trono, Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID:Addgene_12259) using JetPEI (Polyplus Transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... for optogenetic control: Two 400 nl injection of AAV2retro-GAG-ChR2 (Addgene 28017, 7 × 1012 VG/ml) or AAV2retro-CaMKIIa-stGtACR2-FusionRed (Addgene 105669 ...
-
bioRxiv - Cell Biology 2023Quote: ... mTagBFP-Nucleus-7 was a gift from Michael Davidson (Addgene plasmid # 55265 ; http://n2t.net/addgene:55265 ; RRID:Addgene_55265). TCAB1 was knocked-out using a single sgRNA or two separate sgRNA and Cas9 encoding plasmids that were transfected alongside a GFP-expressing plasmid ...
-
bioRxiv - Cell Biology 2024Quote: GFP11 and GFP11×7 plasmids from DNA preparation step in the appropriate reading frame (RRID: Addgene_172068, Addgene_172067). Ten-m is found is phase 1 thus it is possible to use the AddGene plasmids for GFP11 insertions ...
-
bioRxiv - Cell Biology 2024Quote: GFP11 and GFP11×7 plasmids from DNA preparation step in the appropriate reading frame (RRID: Addgene_172068, Addgene_172067). Ten-m is found is phase 1 thus it is possible to use the AddGene plasmids for GFP11 insertions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the LPutopia-8 genome-targeting vector was constructed based on the earlier version LPutopia-7 (Addgene #199212) assembled in the previous studies28 ...
-
bioRxiv - Neuroscience 2020Quote: [4] QF2w-Hsp70frompQF2wWB(Addgene plasmid #61313) (Primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (4 µg, Addgene plasmid # 12260) and pAdVAntage (1.6 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μg of psPAX2 (Addgene #12260) and 8 μg of purified pLKO.1 plasmid containing the shRNA constructs upon reaching 70% confluency ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μg of psPAX2 (Addgene, 12260), and 6 μg of GIPZ Non-silencing Lentiviral shRNA (control ...
-
bioRxiv - Genetics 2019Quote: ... into the all-in-one lentivirus vector LentiCRISPRv2 (a gift from Feng Zhang; Addgene plasmid # 52961) (Sanjana et al. ...
-
bioRxiv - Cell Biology 2021Quote: Each pair of sgRNAs cloned into All-In-One (AIO) CRISPR/Cas9 nickase plasmids (#74119, Addgene) and sequences are shown in table 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Mice were injected with one of the four viruses: rAAV1/EF1α1.1-FLPX-rc [Chronos-GFP] (Addgene plasmid #122102 ...
-
bioRxiv - Cancer Biology 2022Quote: CD73 gene-editing was generated by electroporation of all-in-one CRISPR/Cas9 vector (px330, Addgene) expressing the 20mer target sequence GCAGCACGTTGGGTTCGGCG (exon1) ...
-
bioRxiv - Cell Biology 2024Quote: ... one of the gRNAs was cloned into SpCas9(BB)-2A-GFP (px458) plasmid (Addgene; Cat #48138), and the other gRNA was cloned into the px330-mCherry plasmid (modified from Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... sgRNA sequences listed in Extended Data Table 7 were cloned into the lentiGuide-Crimson backbone (Addgene Plasmid # 70683). Non-replicating lentiviruses were generated by transient co-transfection of the transfer plasmids into HEK293T together with the packaging plasmids pMDL (Addgene Plasmid #12251) ...
-
bioRxiv - Genetics 2020Quote: ... followed by incubation of annealed gRNA with 7 pmol of purified Cas9 (made after expression of Addgene #69090) [49] ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920; http://n2t.net/addgene:54920; RRID:Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 54967 ...