-
No products found
because this supplier's products are not listed.
Diane S. Abou, et al.,
bioRxiv - Pharmacology and Toxicology 2018
Quote:
The scattering phantom was constructed by casting a 1% (w/v) agar gel (Invitrogen) in a 10 mL syringe ...
-
No products found
because this supplier's products are not listed.
Shahinez Garcia, et al.,
bioRxiv - Plant Biology 2015
Quote:
... and 15μg were separated on acrylamide gel (BIORAD mini-protean casting system), blotted ...
-
No products found
because this supplier's products are not listed.
Quote:
... Puromycin resistance cassette was replaced by Hygromycin cassette from pLKO.1 Hygro (Addgene Ref. 24150) using BamHI and KpnI sites ...
-
No products found
because this supplier's products are not listed.
Quote:
Devices were made by casting polydimethylsiloxane (PDMS, Sylgard 184, Dow Corning) over the master wafers followed by degassing and curing at 80°C for 6-8 hours ...
-
No products found
because this supplier's products are not listed.
Timothy Notton, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The 1.4 kb transposon cassettes were excised and cleaned using Qiagen Gel Extraction Kit (Qiagen) and Zymo DNA columns.
-
No products found
because this supplier's products are not listed.
Klaudia Kulczynska, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... six repeats of CASTing selected binding sites synthesized by SIGMA-ALDRICH were introduced upstream of the TKmini promoter ...
-
No products found
because this supplier's products are not listed.
Zhong Tian, et al.,
bioRxiv - Immunology 2018
Quote:
Vertical electrophoresis (Mini-PROTEAN Tetra), Horizontal electrophoresis(YCP-31DN) ...
-
No products found
because this supplier's products are not listed.
Quote:
... The PCR amplicons were separated by gel electrophoresis and the sgRNA expression cassettes were extracted using the Wizard SV gel and PCR cleanup kit (Promega). The amplified sgRNA expression cassettes were checked with Nanodrop to confirm good DNA quality.
-
No products found
because this supplier's products are not listed.
Sachin Khurana, et al.,
bioRxiv - Microbiology 2018
Quote:
... The BLE cassette was then was then amplified using Primestar Max (Takara) containing homologous flanking regions to either side of the Cas9 cut site with primers 5’-TGTCTGCTCAACCACCGTCGCTTGCTGTT AGGCCTCGTCGTCTAGAAGGTGGATGCG GGA-3’ and 5’-TGAATGGGAGACACGAGAGGAAGACGG TAAGAACTGAGCGATGTGGAGTCGTCTC AAGCG-3’ ...
-
No products found
because this supplier's products are not listed.
Galen Dods, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... Transcriptional cassettes were constructed using BsaI-HF v2 (NEB). Multigene plasmids were constructed using FastDigest Esp3I ...
-
No products found
because this supplier's products are not listed.
Timothy Notton, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... barcode cassettes were column purified (Zymo). A 3’-dT overhang was added with a 3’→5’ exonuclease-deficient Klenow Fragment of E ...
-
No products found
because this supplier's products are not listed.
Quote:
... PCR products were separated by gel electrophoresis in 2.2% agarose DNA cassettes (Lonza) and visualized using the FlashGel System.
-
No products found
because this supplier's products are not listed.
Nalini V. Gorantla, et al.,
bioRxiv - Neuroscience 2018
Quote:
... 24 hour and 72 hours (end point) and resolved 10% SDS-PAGE using miniVE Vertical Electrophoresis System from GE healthcare. Further the SDS-PAGE were quantified and analyzed using Gel Doc™ XR+ System and image lab software.
-
No products found
because this supplier's products are not listed.
Quote:
Anatomical and functional images were collected in a vertical magnet (4.7T, 60 cm vertical bore; Bruker Biospec) equipped with a Bruker S380 gradient coil ...
-
No products found
because this supplier's products are not listed.
Quote:
... The cassette was synthesized as dsDNA (GenScript, Piscataway, NJ) in plasmid pUC57 with flanking PmeI sites ...
-
No products found
because this supplier's products are not listed.
Amanda P. Smith, et al.,
bioRxiv - Microbiology 2019
Quote:
... and ERM resistance cassette were amplified at the cycle conditions indicated in Table S2 (EasyA PCR kit (Agilent Tech) and BioRad T100 thermal cycler) ...
-
No products found
because this supplier's products are not listed.
Emily Bowler, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... on a 0.9% agarose gel using GelRed® Nucleic Acid Gel Stain (Biotium) and imaged using a G:BOX Ef imaging system (Syngene ...
-
No products found
because this supplier's products are not listed.
Quote:
... and pulled with a vertical Narishige puller (World Precision Instruments). The solution contained (in mM) ...
-
No products found
because this supplier's products are not listed.
Robin Hoeven, et al.,
bioRxiv - Bioengineering 2019
Quote:
... PCR products were analysed by agarose gel electrophoresis and gel purified using the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel). Constructs were transformed into E ...
-
No products found
because this supplier's products are not listed.
Gerben van Hameren, et al.,
bioRxiv - Neuroscience 2018
Quote:
... was pulled with a Vertical Micropipette Puller (Sutter Instruments, P30-682) to form a glass needle ...
-
No products found
because this supplier's products are not listed.
Wanling Xuan, Mahmood Khan, Muhammad Ashraf,
bioRxiv - Cell Biology 2020
Quote:
... Images were taken by a vertical microscope (Olympus, Japan). Fibrosis and necrosis were determined using the ImageJ software (NIH ...
-
No products found
because this supplier's products are not listed.
Quote:
... supernatants were loaded onto SDS-polyacrylamide gel and the gel was stained using InstantBlue (Expedeon). Gel lanes were cut into pieces and subsequently washed ...
-
No products found
because this supplier's products are not listed.
Quote:
... The steroid standards and products were separated on silica gel-coated aluminum TLC plates (Silica gel 60 F254: thickness, 0.2 mm; 20 × 20 cm; Merck) using dichloromethane:ethyl acetate:ethanol (14:4:0.05 ...
-
No products found
because this supplier's products are not listed.
Quote:
... on a vertical puller (model PP830, Narishige International Ltd, London UK). Electrodes (tip resistance approximately 5 MΩ ...
-
No products found
because this supplier's products are not listed.
Kevin C. Allan, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... equipped with a 5µl dispense cassette (BioTek) and were incubated at 37°C for at least 1 hour ...
-
No products found
because this supplier's products are not listed.
Silvia Di Maio, et al.,
bioRxiv - Genetics 2019
Quote:
... DNA was extracted from the gel slices using the peqGOLD Gel Extraction Kit (VWR). Genotyping was done using a modified ast-PCR protocol for R21X (Supplemental methods ...
-
No products found
because this supplier's products are not listed.
Quote:
... 1 μg/ml solution of CD79a in a vertical five slide mailer (model 715409, Electron Microscopy Science, Hatfield, PA) stained 36 sequentially placed tissue sections with an average staining variation intensity of -4% ±6% from time zero.
-
No products found
because this supplier's products are not listed.
Lianna Fung, et al.,
bioRxiv - Cell Biology 2017
Quote:
... or plasmid control were transfected with pJM101/L1RP or RT-dead L1 plasmid (containing neomycin resistance retrotransposition indicator cassette) per well using X-treme gene HP DNA transfection reagent (06366236001, Roche) according to manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Daniel Duzdevich, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Polyacrylamide gels were prepared with the SequaGel - Urea Gel system (National Diagnostics). A 50 ml mix to yield a 20% gel was degassed under house vacuum with stirring for ∼10 minutes before the addition of 10 μl tetramethylethylenediamine (TEMED ...
-
No products found
because this supplier's products are not listed.
Quote:
... One gel was analyzed by LI-COR Odyssey and another by MS Western using bands of CP03 and BSA as standard and reference proteins ...
-
No products found
because this supplier's products are not listed.
Quote:
... Vertical skin sections (150 μm thick) were made using a cryostat (Leica) and washed with PBS to remove remnant OCT compound ...
-
No products found
because this supplier's products are not listed.
Quote:
... The libraries were gel-purified using the E.Z.N.A Gel Extraction Kit (Omega Bio-Tek). Sequencing was performed using a HiSeq 4000 ...
-
No products found
because this supplier's products are not listed.
Avi I. Flamholz, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... A humidity cassette (Tecan) was refilled daily with distilled water to mitigate evaporation during multi-day cultivation at 37 °C ...
-
No products found
because this supplier's products are not listed.
Quote:
... A custom Taqman probe set designed against the β-galactosidase sequence used in the reporter cassette was used to measure transcript produced specifically from the reporter allele (proprietary probe and primer sequences, PerkinElmer Applied Biosystems). Data acquisition and analysis utilised the ABI PRISM® 7700 sequence detection system (PerkinElmer Applied Biosystems) ...
-
No products found
because this supplier's products are not listed.
Eva K. Brinkman, et al.,
bioRxiv - Molecular Biology 2017
Quote:
... PCR product was cut from gel to remove the primer dimers and cleaned with PCR Isolate II PCR and Gel Kit (Bioline). The isolated samples were sequenced by Illumina MiSeq ...
-
No products found
because this supplier's products are not listed.
Quote:
... The gRNA cassette was synthesized (Biomatik) and inserted into a unique Acc65I site in the vector ...
-
No products found
because this supplier's products are not listed.
Quote:
... The floxed PGK-neo cassette was removed by crossing with Meox2-Cre mice (The Jackson Laboratory). Genotyping of Lin28a mutant mice was performed by PCR analysis ...
-
No products found
because this supplier's products are not listed.
Cameron M. Stauder, et al.,
bioRxiv - Microbiology 2020
Quote:
... agarose gel (Amresco, Solon, OH, USA) made with 0.5% Tris-borate-EDTA buffer (Amresco ...
-
No products found
because this supplier's products are not listed.
Daniel Delgado-Bellido, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... gel electrophoresis and transferred to PVDF membrane (Pall laboratory) by semi-wet blotting.
-
No products found
because this supplier's products are not listed.
Quote:
... Filters were retrieved from inside black polypropylene filter cassettes opened with a Stainless Steel SureSeal Cassette Opener (SKC Inc., Eighty Four, PA) and placed inside a 15 mL conical tube containing 1 mL infection media ...
-
No products found
because this supplier's products are not listed.
Quote:
... after which the fraction of infected Pfeiffer cells were counted by flow cytometric analysis of the red fluorescent protein encoded by the ClonTracer cassette (BD LSRII, ex:488nm, em:575/26nm), having first gated out dead cells (Violet Viability kit ...
-
No products found
because this supplier's products are not listed.
Tim Regan, et al.,
bioRxiv - Genomics 2018
Quote:
... using the TruSeq DNA Nano gel free library kits (Illumina). For comparison ...
-
No products found
because this supplier's products are not listed.
Quote:
... Vertical profiles of physicochemical parameters were taken by a YSI multiprobe (Yellow Springs Instruments, model 6600, Yellow Springs, OH, USA) and profiles of different phytoplankton groups differentiated by their fluorescent spectra were obtained with a fluorescence probe (FluoroProbe ...
-
No products found
because this supplier's products are not listed.
Timothy Notton, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Transposon Cassettes were inserted into pNL4-3 by in vitro transposition with EZ-Tn5 transposase (Epicentre) per manufacturer’s protocol and with equal mols of plasmid template and transposon ...
-
No products found
because this supplier's products are not listed.
Quote:
... PCR products underwent agarose gel electrophoresis and gel purification (Universal DNA purification kit, Tiangen, Beijing, China). For animal experiments ...
-
No products found
because this supplier's products are not listed.
Quote:
... Gels were stained with SyproRed (Lonza Rockland) and scanned using a Typhoon scanner (GE Healthcare) ...
-
No products found
because this supplier's products are not listed.
Quote:
Resulting PCR products were separated by gel electrophoresis and bands of the correct size were excised and extracted with a FavorPrep Gel Purification Kit (Favorgen) following the bench protocol ...
-
No products found
because this supplier's products are not listed.
Quote:
... Individual gel slices in 1.5 mL tubes (Eppendorf) were consecutively washed with water and incubated with 25mM ammonium bicarbonate ...
-
No products found
because this supplier's products are not listed.
Quote:
... PCR products were verified using gel electrophoresis (1% agarose gel) and cleaned with AMPure XP beads (Agencourt, Beckman Coulter Inc., Pasadena, CA, USA). Amplicons were then indexed using the Nextera XT Index Kit V2 set A and set D (Illumina ...
-
No products found
because this supplier's products are not listed.
Clinton K. Lau, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The sample was gel filtered using a TSKgel G4000SWXL (TOSOH Bioscience) equilibrated in 25 mM Hepes-KOH pH 7.2 ...