1 - 50 of 136
suppliers found for
Vertical Gel Casting Cassettes
» view 15 matched products-
BioDesign of NY Sponsored
Cat# G301, USD $59.00/EA Ask
-
Thermo Fisher
No products found because this supplier's products are not listed.Cited in First Whole-Body Three-Dimensional Tomographic Imaging of Alpha Particle Emitting Radium-223bioRxiv - Pharmacology and Toxicology 2018Quote: The scattering phantom was constructed by casting a 1% (w/v) agar gel (Invitrogen) in a 10 mL syringe ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Zoology 2020, published in The Journal of Experimental Biology doi: 10.1242/jeb.229989Quote: ... The AA-Hoefer SE600 Vertical Gel Electrophoresis apparatus was set up with 6L running buffer (10% BioRad 10× Tris/Glycine/SDS #1610732 ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2018, published in Cell Death & Disease doi: 10.1038/s41419-018-1096-6Quote: ... Puromycin resistance cassette was replaced by Hygromycin cassette from pLKO.1 Hygro (Addgene Ref. 24150) using BamHI and KpnI sites ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2018, published in Nucleic Acids Research doi: 10.1093/nar/gky1173Quote: Devices were made by casting polydimethylsiloxane (PDMS, Sylgard 184, Dow Corning) over the master wafers followed by degassing and curing at 80°C for 6-8 hours ... -
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019Quote: ... six repeats of CASTing selected binding sites synthesized by SIGMA-ALDRICH were introduced upstream of the TKmini promoter ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2020, published in mBio doi: 10.1128/mBio.01724-20Quote: ... The 1.4 kb transposon cassettes were excised and cleaned using Qiagen Gel Extraction Kit (Qiagen) and Zymo DNA columns. -
Promega
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2018, published in Molecular Therapy - Nucleic Acids doi: 10.1016/j.omtn.2018.11.008Quote: ... The PCR amplicons were separated by gel electrophoresis and the sgRNA expression cassettes were extracted using the Wizard SV gel and PCR cleanup kit (Promega). The amplified sgRNA expression cassettes were checked with Nanodrop to confirm good DNA quality. -
Protean
No products found because this supplier's products are not listed.bioRxiv - Immunology 2018Quote: Vertical electrophoresis (Mini-PROTEAN Tetra), Horizontal electrophoresis(YCP-31DN) ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2018Quote: ... The BLE cassette was then was then amplified using Primestar Max (Takara) containing homologous flanking regions to either side of the Cas9 cut site with primers 5’-TGTCTGCTCAACCACCGTCGCTTGCTGTT AGGCCTCGTCGTCTAGAAGGTGGATGCG GGA-3’ and 5’-TGAATGGGAGACACGAGAGGAAGACGG TAAGAACTGAGCGATGTGGAGTCGTCTC AAGCG-3’ ... -
New England Biolabs
No products found because this supplier's products are not listed.Cited in Accurate prediction of genetic circuit behavior requires multidimensional characterization of partsbioRxiv - Synthetic Biology 2020Quote: ... Transcriptional cassettes were constructed using BsaI-HF v2 (NEB). Multigene plasmids were constructed using FastDigest Esp3I ... -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2020Quote: ... cassette YAS2-TPDC6 (Genscript_002) amplified using primer pair pYDA16/17 and PPGK1 overlapping with YAS2-TPDC6 using primer pair pYDA18/19 ... -
Zymo Research
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2020, published in mBio doi: 10.1128/mBio.01724-20Quote: ... barcode cassettes were column purified (Zymo). A 3’-dT overhang was added with a 3’→5’ exonuclease-deficient Klenow Fragment of E ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2017, published in PLOS ONE doi: 10.1371/journal.pone.0175968Quote: ... PCR products were separated by gel electrophoresis in 2.2% agarose DNA cassettes (Lonza) and visualized using the FlashGel System. -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018Quote: ... 24 hour and 72 hours (end point) and resolved 10% SDS-PAGE using miniVE Vertical Electrophoresis System from GE healthcare. Further the SDS-PAGE were quantified and analyzed using Gel Doc™ XR+ System and image lab software. -
BioSpec
No products found because this supplier's products are not listed.bioRxiv - Animal Behavior and Cognition 2018, published in Scientific Reports doi: 10.1038/s41598-018-33567-9Quote: Anatomical and functional images were collected in a vertical magnet (4.7T, 60 cm vertical bore; Bruker Biospec) equipped with a Bruker S380 gradient coil ... -
Biotium Inc.
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019Quote: ... on a 0.9% agarose gel using GelRed® Nucleic Acid Gel Stain (Biotium) and imaged using a G:BOX Ef imaging system (Syngene ... -
World Precision Instruments
No products found because this supplier's products are not listed.Cited in Functional recruitment of dynamin requires multimeric interactions for efficient endocytosisbioRxiv - Cell Biology 2019, published in Nature Communications doi: 10.1038/s41467-019-12434-9Quote: ... and pulled with a vertical Narishige puller (World Precision Instruments). The solution contained (in mM) ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019Quote: ... and ERM resistance cassette were amplified at the cycle conditions indicated in Table S2 (EasyA PCR kit (Agilent Tech) and BioRad T100 thermal cycler) ... -
Macherey-Nagel GmbH
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2019Quote: ... PCR products were analysed by agarose gel electrophoresis and gel purified using the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel). Constructs were transformed into E ... -
Sutter Instruments
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018Quote: ... was pulled with a Vertical Micropipette Puller (Sutter Instruments, P30-682) to form a glass needle ... -
Olympus
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... Images were taken by a vertical microscope (Olympus, Japan). Fibrosis and necrosis were determined using the ImageJ software (NIH ... -
Expedeon
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in Journal of Biological Chemistry doi: 10.1074/jbc.RA119.011025Quote: ... supernatants were loaded onto SDS-polyacrylamide gel and the gel was stained using InstantBlue (Expedeon). Gel lanes were cut into pieces and subsequently washed ... -
Merck
No products found because this supplier's products are not listed.Cited in Retroconversion of estrogens into androgens by bacteria via a cobalamin-mediated methylationbioRxiv - Microbiology 2019, published in Proceedings of the National Academy of Sciences doi: 10.1073/pnas.1914380117Quote: ... The steroid standards and products were separated on silica gel-coated aluminum TLC plates (Silica gel 60 F254: thickness, 0.2 mm; 20 × 20 cm; Merck) using dichloromethane:ethyl acetate:ethanol (14:4:0.05 ... -
Narishige International
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in Cold Spring Harbor Symposia on Quantitative Biology doi: 10.1101/sqb.2018.83.037531Quote: ... on a vertical puller (model PP830, Narishige International Ltd, London UK). Electrodes (tip resistance approximately 5 MΩ ... -
Biotek
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2020Quote: ... equipped with a 5µl dispense cassette (BioTek) and were incubated at 37°C for at least 1 hour ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.Cited in Multiplex staining by sequential immunostaining and antibody removal on routine tissue sectionsbioRxiv - Pathology 2017, published in The Journal Of Histochemistry And Cytochemistry doi: 10.1369/0022155417719419Quote: ... 1 μg/ml solution of CD79a in a vertical five slide mailer (model 715409, Electron Microscopy Science, Hatfield, PA) stained 36 sequentially placed tissue sections with an average staining variation intensity of -4% ±6% from time zero. -
Roche
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2017Quote: ... or plasmid control were transfected with pJM101/L1RP or RT-dead L1 plasmid (containing neomycin resistance retrotransposition indicator cassette) per well using X-treme gene HP DNA transfection reagent (06366236001, Roche) according to manufacturer instructions ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Genetics 2019, published in Genome Medicine doi: 10.1186/s13073-020-00771-0Quote: ... DNA was extracted from the gel slices using the peqGOLD Gel Extraction Kit (VWR). Genotyping was done using a modified ast-PCR protocol for R21X (Supplemental methods ... -
National Diagnostics
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2020Quote: Polyacrylamide gels were prepared with the SequaGel - Urea Gel system (National Diagnostics). A 50 ml mix to yield a 20% gel was degassed under house vacuum with stirring for ∼10 minutes before the addition of 10 μl tetramethylethylenediamine (TEMED ... -
LI-COR
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2017, published in Molecular & Cellular Proteomics doi: 10.1074/mcp.O117.067082Quote: ... One gel was analyzed by LI-COR Odyssey and another by MS Western using bands of CP03 and BSA as standard and reference proteins ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2018, published in eLife doi: 10.7554/elife.38883Quote: ... Vertical skin sections (150 μm thick) were made using a cryostat (Leica) and washed with PBS to remove remnant OCT compound ... -
Tecan
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2020Quote: ... A humidity cassette (Tecan) was refilled daily with distilled water to mitigate evaporation during multi-day cultivation at 37 °C ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Physiology 2017, published in The Journal of Physiology doi: 10.1113/jp274915Quote: ... A custom Taqman probe set designed against the β-galactosidase sequence used in the reporter cassette was used to measure transcript produced specifically from the reporter allele (proprietary probe and primer sequences, PerkinElmer Applied Biosystems). Data acquisition and analysis utilised the ABI PRISM® 7700 sequence detection system (PerkinElmer Applied Biosystems) ... -
Omega Bio-Tek
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020, published in RNA Biology doi: 10.1080/15476286.2020.1737443Quote: ... The libraries were gel-purified using the E.Z.N.A Gel Extraction Kit (Omega Bio-Tek). Sequencing was performed using a HiSeq 4000 ... -
Bioline
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2017Quote: ... PCR product was cut from gel to remove the primer dimers and cleaned with PCR Isolate II PCR and Gel Kit (Bioline). The isolated samples were sequenced by Illumina MiSeq ... -
Sartorius
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... ultrafiltration cassettes holder (Sartorius) and three 5 kDa MWCO cassettes (PES ... -
Biomatik Corporation
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2018, published in Molecular Biology of the Cell doi: 10.1091/mbc.e18-09-0605Quote: ... The gRNA cassette was synthesized (Biomatik) and inserted into a unique Acc65I site in the vector ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019, published in eLife doi: 10.7554/eLife.53608Quote: ... The floxed PGK-neo cassette was removed by crossing with Meox2-Cre mice (The Jackson Laboratory). Genotyping of Lin28a mutant mice was performed by PCR analysis ... -
Amresco
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020, published in Mycologia doi: 10.1080/00275514.2020.1797371Quote: ... agarose gel (Amresco, Solon, OH, USA) made with 0.5% Tris-borate-EDTA buffer (Amresco ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in eLife doi: 10.7554/eLife.50036Quote: ... after which the fraction of infected Pfeiffer cells were counted by flow cytometric analysis of the red fluorescent protein encoded by the ClonTracer cassette (BD LSRII, ex:488nm, em:575/26nm), having first gated out dead cells (Violet Viability kit ... -
Pall
No products found because this supplier's products are not listed.Cited in VE-PTP participates in vasculogenic mimicry by preventing autophagic degradation of VE-cadherinbioRxiv - Cancer Biology 2019Quote: ... gel electrophoresis and transferred to PVDF membrane (Pall laboratory) by semi-wet blotting. -
SKC Inc
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2018, published in PLOS ONE doi: 10.1371/journal.pone.0204337Quote: ... Filters were retrieved from inside black polypropylene filter cassettes opened with a Stainless Steel SureSeal Cassette Opener (SKC Inc., Eighty Four, PA) and placed inside a 15 mL conical tube containing 1 mL infection media ... -
Yellow Springs Instrument
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2018, published in Microbiome doi: 10.1186/s40168-018-0563-8Quote: ... Vertical profiles of physicochemical parameters were taken by a YSI multiprobe (Yellow Springs Instruments, model 6600, Yellow Springs, OH, USA) and profiles of different phytoplankton groups differentiated by their fluorescent spectra were obtained with a fluorescence probe (FluoroProbe ... -
TianGen Biotech
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2019, published in The FEBS Journal doi: 10.1111/febs.14816Quote: ... PCR products underwent agarose gel electrophoresis and gel purification (Universal DNA purification kit, Tiangen, Beijing, China). For animal experiments ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Genomics 2018Quote: ... using the TruSeq DNA Nano gel free library kits (Illumina). For comparison ... -
Lucigen
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2020, published in mBio doi: 10.1128/mBio.01724-20Quote: Transposon Cassettes were inserted into pNL4-3 by in vitro transposition with EZ-Tn5 transposase (Epicentre) per manufacturer’s protocol and with equal mols of plasmid template and transposon ... -
IBI Scientific
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2017, published in Journal of Industrial Microbiology & Biotechnology doi: 10.1007/s10295-018-2109-2Quote: ... extracted from gel slices using a Gel/PCR DNA Fragments Extraction Kit (IBI Scientific; procedures as specified by the manufacturer) ... -
Favorgen Biotech
No products found because this supplier's products are not listed.bioRxiv - Genomics 2018, published in Animal Conservation doi: 10.1111/acv.12459Quote: Resulting PCR products were separated by gel electrophoresis and bands of the correct size were excised and extracted with a FavorPrep Gel Purification Kit (Favorgen) following the bench protocol ... -
Eppendorf
No products found because this supplier's products are not listed.bioRxiv - Genomics 2019, published in eLife doi: 10.7554/elife.41740Quote: ... Individual gel slices in 1.5 mL tubes (Eppendorf) were consecutively washed with water and incubated with 25mM ammonium bicarbonate ... -
Tosoh Bioscience
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... The sample was gel filtered using a TSKgel G4000SWXL (TOSOH Bioscience) equilibrated in 25 mM Hepes-KOH pH 7.2 ...