1 - 50 of 316
suppliers found for
Rat Leptin RIA kit
» view 10000+ matched products-
Advanced Targeting Systems Sponsored
Cat# PRP-227CYT-200, 200 micrograms , USD $245.0 Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2018Quote: ... leptin was measured using the Rat Leptin ELISA Kit (Millipore, LOT: 2851208,USA), and the insulin levels were measured using the Rat/Mouse Insulin ELISA Kit (Millipore ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ELISA for serum leptin was conducted using a mouse/rat Leptin Quantikine ELISA Assay kit (R&D Systems, MOB00) at a concentration of 1:2 in LD mice ... -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Animal Behavior and Cognition 2020Quote: ... CORT levels were measured using a radioimmunoassay (RIA) kit according to the manufacturer protocol (ImmuChemTM Double Antibody Corticosterone 125I RIA, MP Biomedicals, USA). -
Merck
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020Quote: ... Leptin and insulin were assessed by ELISAs (Leptin Mouse ELISA kit, ab100718, Abcam; Mouse insulin ELISA ... -
Crystal Chem
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: Plasma Leptin levels were measured by mouse mouse Leptin ELISA kit (Crystal Chem) according to the manufacturer’s instructions. -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2017Quote: ... Rat” Ribo-Zero kit (Illumina) which is also recommended for insect rRNA depletion ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019Quote: ... flat-bottom plate (Corning EIA/RIA plate) overnight at 4 °C and then washed ... -
Alpco Diagnostics
No products found because this supplier's products are not listed.Cited in MetAP2 inhibition reduces food intake and body weight in a ciliopathy mouse model of obesitybioRxiv - Pharmacology and Toxicology 2019, published in JCI Insight doi: 10.1172/jci.insight.134278Quote: ... Insulin and leptin levels were measured using Mouse Ultrasensitive Insulin ELISA and Mouse/Rat Leptin ELISA kits (ALPCO) according to manufacturer’s instructions. -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019Quote: Antibodies against human adiponectin and leptin were purchased from Thermo Fisher (Adiponectin Monoclonal Antibody (19F1); Cat ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019, published in PLOS Biology doi: 10.1371/journal.pbio.3000296Quote: Leptin (3 mg/kg; Peprotech) was injected intraperitoneally in P14 pups ... -
Roche
No products found because this supplier's products are not listed.Cited in Mitotic ER exit site dissociation and reassembly is regulated by TANGO1 phosphorylation statusbioRxiv - Cell Biology 2019Quote: ... HA (rat; Roche), and Sec31 (mouse ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2018Quote: ... and Rat-PE CD117 (c-kit) (BD PharMingen) for 20 min at 4°C ... -
Charles River Labs
No products found because this supplier's products are not listed.bioRxiv - Animal Behavior and Cognition 2020Quote: ... we used SERT−/− rats and wild-type WistarCrI:WI rats (WT rats) from Charles River (Horst, the Netherlands) as behavioral wild-type controls (see experimental design in figure 1) ... -
Beckman
No products found because this supplier's products are not listed.Cited in Sex differences in maturation and attrition rate of adult born neurons in the hippocampus of ratsbioRxiv - Neuroscience 2019Quote: ... Serum 17β-estradiol levels in female rats and serum testosterone levels in male rats were assayed using commercially available radioimmunoassay (RIA) kits from Beckman Coulter (Brea ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Physiology 2018, published in PLOS ONE doi: 10.1371/journal.pone.0197698Quote: ... Rat IL-6 pre-coated ELISA kit (Cat. #437107; BioLegend, San Diego, CA); Mouse/rat ACTH ELISA kit (Cat ... -
ChromoTek
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... rat anti-RFP (ChromoTek) 1:1000 ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2017, published in Traffic doi: 10.1111/tra.12507Quote: ... rat cDNA was generated from PC12 cells using QuantiTect Reverse transcription kit (Qiagen) and an anchored Oligo(dT ... -
Bio-Rad
No products found because this supplier's products are not listed.Cited in Single-cell mapping reveals new markers and functions of lymphatic endothelial cells in lymph nodesbioRxiv - Immunology 2020, published in PLOS Biology doi: 10.1371/journal.pbio.3000704Quote: ... rat anti-CD169 (MCA884, Bio-Rad), rat anti-ITGA2B (BD553847 ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2018, published in Human Molecular Genetics doi: 10.1093/hmg/ddz058Quote: ... or rat (Dako) antibodies were used at a dilution of 1:5000 ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in Journal of Clinical Oncology doi: 10.1200/JCO.2019.37.7_suppl.554Quote: ... Primary antibodies to leptin (dilution 1:100; SC-842, SANTA CRUZ, Dallas, TX, USA), adiponectin (dilution 1:100 ... -
Lucigen
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019, published in eLife doi: 10.7554/eLife.49708Quote: ... rRNA was depleted using the Ribo-Zero kit Human/Mouse/Rat (Epicentre), and libraries were prepared using random priming ... -
Jackson ImmunoResearch
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020, published in PLOS Pathogens doi: 10.1371/journal.ppat.1008985Quote: ... and anti-rat (Jackson ImmunoResearch) secondary antibodies ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018Quote: ... using the Amaxa Rat Neuron Nucleofector Kit (Lonza Cologne AG ... -
Envigo RMS
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: Sprague-Dawley rats and Wistar Unilever outbred rats (strain HsdCpb:WU, Envigo, Horst, The Netherlands) were used for isolation of primary hippocampal neurons ... -
Bio X Cell
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019Quote: ... Rat-IgG (2A3, BioXcell) and Hamster-IgG (Life Technologies ... -
Mercodia
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020Quote: ... Leptin and insulin were assessed by ELISAs (Leptin Mouse ELISA kit, ab100718, Abcam; Mouse insulin ELISA, #10-1247-01, Mercodia, Sweden) following manufacturer’s instructions in plasma sampled in the saphenous vein after the 6-hour fasting during the GTT test. -
Promega
No products found because this supplier's products are not listed.bioRxiv - Physiology 2018, published in Proceedings of the National Academy of Sciences doi: 10.1073/pnas.1806366115Quote: ... pLE1-firefly luciferase was generated by cloning 115bp leptin enhancer 1(LE1)(GAGAACACTTAACAGCAAAGGTTAATCTTTGAAGTCCCTAAAGATTTGAACTTTCCGCAGAATTGGCTGCAGCGTCTAGTGGGTTAGAGTCTAATTGGAGTAGAGCAGAAGCAAG) into pGL4.27 (Promega) between XhoI and HindIII sites ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2018, published in PLOS Pathogens doi: 10.1371/journal.ppat.1007445Quote: ... or NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England BioLabs, E6310L). After rRNA depletion libraries were prepared according to manufacturer’s instructions using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Acta Neuropathologica doi: 10.1007/s00401-019-02011-1Quote: ... and anti-Rat biotinylated (1:100, Vector Labs) followed by peroxidase-conjugated streptavidin ... -
Takara Bio
No products found because this supplier's products are not listed.Cited in Rac-dependent signaling from keratinocytes promotes differentiation of intradermal white adipocytesbioRxiv - Cell Biology 2018, published in Journal of Investigative Dermatology doi: 10.1016/j.jid.2019.06.140Quote: Rat primary white pre-adipocytes and rat primary brown pre-adipocytes were purchased from TaKaRa Bio Inc ... -
Novus Biologicals
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in Current Biology doi: 10.1016/j.cub.2018.12.012Quote: ... and rat anti-FLAG (1:300, Novus Biologicals). The following secondary antibodies were obtained from Jackson ImmunoResearch ... -
Cedarlane
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in Scientific Reports doi: 10.1038/s41598-020-67755-3Quote: ... Secreted insulin and insulin content were measured by radioimmunoassay (Rat insulin RIA Kit, Cedarlane, Burlington, ON, CA) or using the Mouse Ultrasensitive Insulin ELISA kit (ALPCO ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Physiology 2018, published in Proceedings of the National Academy of Sciences doi: 10.1073/pnas.1806366115Quote: ... Leptin-luciferase reporter BACs were used to generate transgenic animals in the inbred FVB N/J background (Jackson Lab) using common pronuclear injection techniques (17 ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018Quote: ... donkey anti-rat HRP from GE Healthcare, goat anti-guinea pig HRP from Santa Cruz ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.Cited in Therapeutic suppression of proteolipid protein rescues Pelizaeus-Merzbacher Disease in micebioRxiv - Neuroscience 2018, published in Nature doi: 10.1038/s41586-020-2494-3Quote: ... goat anti-rat HRP (1:2500, 7077, Cell Signaling), or IRDye secondaries (1:20000 ... -
Miltenyi Biotec
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ... ECs cells were labelled with rat anti-mouse CD31 microbeads (Miltenyi Biotec). Labelled ECs and attached cells were then isolated magnetically ... -
Zymo Research
No products found because this supplier's products are not listed.Cited in SABER enables highly multiplexed and amplified detection of DNA and RNA in cells and tissuesbioRxiv - Genetics 2018, published in Nature Methods doi: 10.1038/s41592-019-0404-0Quote: ... kit or DNA Clean and Concentrator kit (Zymo, DCC-100) with distilled water elution to reduce volume and salt concentration from the reaction condition ... -
Bethyl
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2018, published in eLife doi: 10.7554/elife.38161Quote: ... DyLight 488 goat anti-rat (BETHYL) secondary antibody was diluted 400 times ... -
LI-COR
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019Quote: ... Goat anti-rat IRDye 680LT (LI-COR) (1:20000). -
Biomatik Corporation
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... Levels of leptin and TNF-α were determined in undiluted samples using the Leptin mouse ELISA kit (Biomatik, EKB01861) and the TNF-α mouse ELISA kit (Biomatik ... -
Salimetrics
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in Psychological Medicine doi: 10.1017/s0033291718001253Quote: ... Hormones were assayed using RIA kits purchased from Salimetrics (Carlsbad, CA) at the UNC Chapel Hill School of Medicine Core Laboratory. -
SouthernBiotech
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2018Quote: ... and anti-rat IgG (Southern Biotech). -
Omega Bio-Tek
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2016, published in mSphere doi: 10.1128/mSphere.00132-16Quote: ... Gel Extraction Kit (Omega Bio-tek). Sanger sequencing was performed by the Penn State Genomics Core Facility utilizing the same primers as used for DNA amplification ... -
Macherey-Nagel GmbH
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019Quote: ... NucleoBond Xtra Midi Kit (Macherey-Nagel) and QIAamp DNA Mini Kit (Qiagen ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in Cell doi: 10.1016/j.cell.2020.03.062Quote: ... sequence (5’-TGAAAGCCACCAGACCTCGA) targeting exon 8 of the murine leptin receptor (LepR) was ligated into the BsmBI site in lentiGuide-Puro (Addgene 52963) with compatible annealed oligos to generate lentiGuide-Puro-sgLepR ... -
Enzo Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019Quote: ... The primary antibodies used were rat anti-PTX3 (Enzo Life Sciences) at a 1:400 dilution ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ... rats received 5 nmol Cat K 680 FAST (CatK) (PerkinElmer, Waltham, MA, USA). CatK is an activatable fluorescent probe that detects in vivo Cathepsin K activity ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019Quote: ... Cells were then permeabilized with 0.3% Triton-X for 15 min followed by 30 min block in 0.1% Triton-X + 5% normal rat serum (Stem Cell Technologies). Cells were incubated in Drp1 p616 Ab overnight at 4°C in 0.1% Triton-X + 1% BSA and then in secondary antibodies (AF488 Goat anti-Rabbit) ... -
Bioline
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019Quote: ... using the amplification kit SensiFAST SYBR No-Rox kit (Bioline, London, UK), according to the manufacturer’s instructions ...