-
No products found
because this supplier's products are not listed.
Zhigang Li, et al.,
bioRxiv - Biochemistry 2018
Quote:
... leptin was measured using the Rat Leptin ELISA Kit (Millipore, LOT: 2851208,USA), and the insulin levels were measured using the Rat/Mouse Insulin ELISA Kit (Millipore ...
-
No products found
because this supplier's products are not listed.
Kelsey H. Collins, et al.,
bioRxiv - Physiology 2020
Quote:
ELISA for serum leptin was conducted using a mouse/rat Leptin Quantikine ELISA Assay kit (R&D Systems, MOB00) at a concentration of 1:2 in LD mice ...
-
No products found
because this supplier's products are not listed.
Danielle M. Diniz, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... CORT levels were measured using a radioimmunoassay (RIA) kit according to the manufacturer protocol (ImmuChemTM Double Antibody Corticosterone 125I RIA, MP Biomedicals, USA).
-
No products found
because this supplier's products are not listed.
Karolina Wołodko, et al.,
bioRxiv - Physiology 2020
Quote:
... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ...
-
No products found
because this supplier's products are not listed.
Marine Tournissac, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Leptin and insulin were assessed by ELISAs (Leptin Mouse ELISA kit, ab100718, Abcam; Mouse insulin ELISA ...
-
No products found
because this supplier's products are not listed.
Mitsugu Shimobayashi, et al.,
bioRxiv - Physiology 2020
Quote:
Plasma Leptin levels were measured by mouse mouse Leptin ELISA kit (Crystal Chem) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Nerea Irigoyen, et al.,
bioRxiv - Microbiology 2017
Quote:
... Rat” Ribo-Zero kit (Illumina) which is also recommended for insect rRNA depletion ...
-
No products found
because this supplier's products are not listed.
Quote:
... Insulin and leptin levels were measured using Mouse Ultrasensitive Insulin ELISA and Mouse/Rat Leptin ELISA kits (ALPCO) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
So Yun Min, et al.,
bioRxiv - Physiology 2019
Quote:
Antibodies against human adiponectin and leptin were purchased from Thermo Fisher (Adiponectin Monoclonal Antibody (19F1); Cat ...
-
No products found
because this supplier's products are not listed.
Richard C.A. Sainson, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... flat-bottom plate (Corning EIA/RIA plate) overnight at 4 °C and then washed ...
-
No products found
because this supplier's products are not listed.
Quote:
Leptin (3 mg/kg; Peprotech) was injected intraperitoneally in P14 pups ...
-
No products found
because this supplier's products are not listed.
Miharu Maeda, Yukie Komatsu, Kota Saito,
bioRxiv - Cell Biology 2019
Quote:
... HA (rat; Roche), and Sec31 (mouse ...
-
No products found
because this supplier's products are not listed.
Amankeldi A. Salybekov, et al.,
bioRxiv - Cell Biology 2018
Quote:
... and Rat-PE CD117 (c-kit) (BD PharMingen) for 20 min at 4°C ...
-
No products found
because this supplier's products are not listed.
Shunya Yagi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Serum 17β-estradiol levels in female rats and serum testosterone levels in male rats were assayed using commercially available radioimmunoassay (RIA) kits from Beckman Coulter (Brea ...
-
No products found
because this supplier's products are not listed.
Danielle M. Diniz, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... we used SERT−/− rats and wild-type WistarCrI:WI rats (WT rats) from Charles River (Horst, the Netherlands) as behavioral wild-type controls (see experimental design in figure 1) ...
-
No products found
because this supplier's products are not listed.
Quote:
... Rat IL-6 pre-coated ELISA kit (Cat. #437107; BioLegend, San Diego, CA); Mouse/rat ACTH ELISA kit (Cat ...
-
No products found
because this supplier's products are not listed.
Hugo Girão, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rat anti-RFP (ChromoTek) 1:1000 ...
-
No products found
because this supplier's products are not listed.
Quote:
... rat cDNA was generated from PC12 cells using QuantiTect Reverse transcription kit (Qiagen) and an anchored Oligo(dT ...
-
No products found
because this supplier's products are not listed.
Quote:
... rat anti-CD169 (MCA884, Bio-Rad), rat anti-ITGA2B (BD553847 ...
-
No products found
because this supplier's products are not listed.
Quote:
... or rat (Dako) antibodies were used at a dilution of 1:5000 ...
-
No products found
because this supplier's products are not listed.
Quote:
... Primary antibodies to leptin (dilution 1:100; SC-842, SANTA CRUZ, Dallas, TX, USA), adiponectin (dilution 1:100 ...
-
No products found
because this supplier's products are not listed.
Gregory L. Sousa, et al.,
bioRxiv - Microbiology 2020
Quote:
... and anti-rat (Jackson ImmunoResearch) secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Quote:
... rRNA was depleted using the Ribo-Zero kit Human/Mouse/Rat (Epicentre), and libraries were prepared using random priming ...
-
No products found
because this supplier's products are not listed.
Katarzyna O. Rojek, et al.,
bioRxiv - Neuroscience 2018
Quote:
... using the Amaxa Rat Neuron Nucleofector Kit (Lonza Cologne AG ...
-
No products found
because this supplier's products are not listed.
J. Secklehner, et al.,
bioRxiv - Immunology 2019
Quote:
... Rat-IgG (2A3, BioXcell) and Hamster-IgG (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Quote:
... All rats had unlimited access to rodent chow (Teklad LM-485 Mouse/Rat 7012, Envigo) and water in the home cage and were individually housed in a temperature- and humidity-controlled vivarium maintained on a 12-h light-dark cycle (lights on from 0600 to 1800) ...
-
No products found
because this supplier's products are not listed.
Marine Tournissac, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Leptin and insulin were assessed by ELISAs (Leptin Mouse ELISA kit, ab100718, Abcam; Mouse insulin ELISA, #10-1247-01, Mercodia, Sweden) following manufacturer’s instructions in plasma sampled in the saphenous vein after the 6-hour fasting during the GTT test.
-
No products found
because this supplier's products are not listed.
Quote:
... pLE1-firefly luciferase was generated by cloning 115bp leptin enhancer 1(LE1)(GAGAACACTTAACAGCAAAGGTTAATCTTTGAAGTCCCTAAAGATTTGAACTTTCCGCAGAATTGGCTGCAGCGTCTAGTGGGTTAGAGTCTAATTGGAGTAGAGCAGAAGCAAG) into pGL4.27 (Promega) between XhoI and HindIII sites ...
-
No products found
because this supplier's products are not listed.
Quote:
... or NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England BioLabs, E6310L). After rRNA depletion libraries were prepared according to manufacturer’s instructions using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs ...
-
No products found
because this supplier's products are not listed.
Quote:
... and anti-Rat biotinylated (1:100, Vector Labs) followed by peroxidase-conjugated streptavidin ...
-
No products found
because this supplier's products are not listed.
Quote:
... and rat anti-FLAG (1:300, Novus Biologicals). The following secondary antibodies were obtained from Jackson ImmunoResearch ...
-
No products found
because this supplier's products are not listed.
Quote:
... Secreted insulin and insulin content were measured by radioimmunoassay (Rat insulin RIA Kit, Cedarlane, Burlington, ON, CA) or using the Mouse Ultrasensitive Insulin ELISA kit (ALPCO ...
-
No products found
because this supplier's products are not listed.
Quote:
Rat primary white pre-adipocytes and rat primary brown pre-adipocytes were purchased from TaKaRa Bio Inc ...
-
No products found
because this supplier's products are not listed.
Quote:
... Leptin-luciferase reporter BACs were used to generate transgenic animals in the inbred FVB N/J background (Jackson Lab) using common pronuclear injection techniques (17 ...
-
No products found
because this supplier's products are not listed.
Sandra Franco-Iborra, et al.,
bioRxiv - Neuroscience 2018
Quote:
... donkey anti-rat HRP from GE Healthcare, goat anti-guinea pig HRP from Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Quote:
... kit or DNA Clean and Concentrator kit (Zymo, DCC-100) with distilled water elution to reduce volume and salt concentration from the reaction condition ...
-
No products found
because this supplier's products are not listed.
Quote:
... DyLight 488 goat anti-rat (BETHYL) secondary antibody was diluted 400 times ...
-
No products found
because this supplier's products are not listed.
Alex Hunt, et al.,
bioRxiv - Microbiology 2019
Quote:
... Goat anti-rat IRDye 680LT (LI-COR) (1:20000).
-
No products found
because this supplier's products are not listed.
Matthew S. Elitt, et al.,
bioRxiv - Neuroscience 2018
Quote:
... goat anti-rat HRP (1:2500, 7077, Cell Signaling), or IRDye secondaries (1:20000 ...
-
No products found
because this supplier's products are not listed.
Sarah Guimbal, et al.,
bioRxiv - Physiology 2020
Quote:
... ECs cells were labelled with rat anti-mouse CD31 microbeads (Miltenyi Biotec). Labelled ECs and attached cells were then isolated magnetically ...
-
No products found
because this supplier's products are not listed.
Audrey Caron, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Levels of leptin and TNF-α were determined in undiluted samples using the Leptin mouse ELISA kit (Biomatik, EKB01861) and the TNF-α mouse ELISA kit (Biomatik ...
-
No products found
because this supplier's products are not listed.
Quote:
... Hormones were assayed using RIA kits purchased from Salimetrics (Carlsbad, CA) at the UNC Chapel Hill School of Medicine Core Laboratory.
-
Insulin ELISA / assay Kit
Cat# K046-H1,
1x96 well plate, USD $445.0/ea
Ask
Quote:
... leptin and insulin were analyzed by commercial ELISA’s according to manufacturer’s instructions (EIA CORT kit, Arbor Assays, Michigan ...
-
No products found
because this supplier's products are not listed.
Quote:
... sequence (5’-TGAAAGCCACCAGACCTCGA) targeting exon 8 of the murine leptin receptor (LepR) was ligated into the BsmBI site in lentiGuide-Puro (Addgene 52963) with compatible annealed oligos to generate lentiGuide-Puro-sgLepR ...
-
No products found
because this supplier's products are not listed.
Hui San Chin, et al.,
bioRxiv - Cell Biology 2018
Quote:
... and anti-rat IgG (Southern Biotech).
-
No products found
because this supplier's products are not listed.
Gaurav Gupta, et al.,
bioRxiv - Immunology 2019
Quote:
... The primary antibodies used were rat anti-PTX3 (Enzo Life Sciences) at a 1:400 dilution ...
-
No products found
because this supplier's products are not listed.
Tristan Maerz, et al.,
bioRxiv - Physiology 2020
Quote:
... rats received 5 nmol Cat K 680 FAST (CatK) (PerkinElmer, Waltham, MA, USA). CatK is an activatable fluorescent probe that detects in vivo Cathepsin K activity ...
-
No products found
because this supplier's products are not listed.
C.G. Weindel, et al.,
bioRxiv - Immunology 2019
Quote:
... Cells were then permeabilized with 0.3% Triton-X for 15 min followed by 30 min block in 0.1% Triton-X + 5% normal rat serum (Stem Cell Technologies). Cells were incubated in Drp1 p616 Ab overnight at 4°C in 0.1% Triton-X + 1% BSA and then in secondary antibodies (AF488 Goat anti-Rabbit) ...
-
No products found
because this supplier's products are not listed.
Antonin Weckel, et al.,
bioRxiv - Microbiology 2019
Quote:
... using the amplification kit SensiFAST SYBR No-Rox kit (Bioline, London, UK), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lamya El Mortaji, et al.,
bioRxiv - Microbiology 2019
Quote:
... NucleoBond Xtra Midi Kit (Macherey-Nagel) and QIAamp DNA Mini Kit (Qiagen ...