-
No products found
because this supplier's products are not listed.
Kinga Szydłowska, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Primers used were: rno-miR-155-5p (RT:002571, ThermoFisher Scientific), and rno-miR-674-3p (RT:001956 ...
-
No products found
because this supplier's products are not listed.
Zhihui Zhu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Relative-fold changes were normalized comparing exosomal micro RNA reference gene miR-30c-5p using the primer hsa-miR-30c-5p miRCURY LNA miRNA PCR Assay (Qiagen 339306, gene globe ID YP00204783). Relative fold changes of miR223-3p of fro/fro mice were calculated to +/fro mice by using the formula ...
-
No products found
because this supplier's products are not listed.
Roberto Frigerio, et al.,
bioRxiv - Biochemistry 2020
Quote:
The miR-16-5p and miR-21-5p expression levels were performed by droplet digital PCR (ddPCR) using the QX100 ddPCR platform (Bio-Rad, Hercules, CA). The QX100 droplet generator was used to generate an emulsion of about 20,000 droplets ...
-
No products found
because this supplier's products are not listed.
Mariska Miranda, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Standard RT-PCR using independent sets of Predesigned KiCqStart® SYBR® Green Primers (Sigma, Table S11) was carried out for validation with independent biological replicates from 2D cultures (n = 2 ...
-
No products found
because this supplier's products are not listed.
Markus Mund, et al.,
bioRxiv - Bioengineering 2022
Quote:
pGRNA-sacB-endA was cloned by PCR-amplification of pGRNA-sacB-ccdB using primers 542 and 543 and subsequent circularization of the PCR product by Gibson assembly (New England Biolabs).
-
No products found
because this supplier's products are not listed.
Yasuo Ariumi,
bioRxiv - Microbiology 2021
Quote:
... real-time RT-PCR was performed with SARS-CoV-2 N primer sets and SYBR Premix Ex Taq II (TaKaRa-Bio) using a LightCycler Nano (Roche ...
-
No products found
because this supplier's products are not listed.
Anna Tejchman-Skrzyszewska, et al.,
bioRxiv - Neuroscience 2023
Quote:
... RT-PCR with random primers (Promega, Madison, WI, USA) and Moloney murine leukemia virus M-MLV reverse transcriptase (Promega ...
-
No products found
because this supplier's products are not listed.
Masahiro Nogami, et al.,
bioRxiv - Neuroscience 2021
Quote:
... hsa-miR-125b-5p Pre-miR™ miRNA Precursor (#AM17100, PM10148, ABI), miR-124-3p ...
-
No products found
because this supplier's products are not listed.
Yi-Chen Chen, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The DNA fragments around the crRNA target site were amplified by a two-step PCR with specific primer sets (Table S2) and Index PCR Primers mentioned in the manufacturer’s instructions (Illumina, USA). After gel purification ...
-
No products found
because this supplier's products are not listed.
T.A. van Gelderen, L. Ribas,
bioRxiv - Molecular Biology 2023
Quote:
... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
No products found
because this supplier's products are not listed.
Kasper Mikkelsen, et al.,
bioRxiv - Microbiology 2023
Quote:
... RT-PCR reactions were set up using the FastStart Essential DNA Green Master kit (Roche), using four different primer pairs ...
-
No products found
because this supplier's products are not listed.
Lindsey M. Euscher, et al.,
bioRxiv - Bioengineering 2022
Quote:
Murine neonatal cardiomyocytes and NHDFs were transfected with miR-146a-5p, miR-126-3p and miR-370-3p mimics (Lightswitch, 100nM final concentration) using Trans-IT TKO (Mirus) in their respective serum free growth media ...
-
No products found
because this supplier's products are not listed.
Michael J. Podolsky, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Quantitative real-time PCR reactions were performed with different sets of primers and Sensifast SYBR (Bioline, Taunton, MA) on a CFX96 or CFX384 Real-Time PCR Detection System (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Andrew S. McNeal, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... pLVX-anti-MIR211-5p (Addgene #153318), pLVX-anti-MIR328-3p (Addgene #153319) ...
-
No products found
because this supplier's products are not listed.
Grant F Marshall, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Primers for reverse-transcription PCR (RT-PCR) and quantitative RT-PCR (qRT-PCR) were supplied by Merck with standard desalting at 100 µM in TE buffer ...
-
No products found
because this supplier's products are not listed.
Karine Pozo, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1 E7335S, Index Primers Set 2, E7500S) with Agencourt AMPure XP magnetic beads (Beckman coulter A63881) exactly as per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Derek M Dykxhoorn, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and miRZip423-5p (anti-miR-423-5p) were purchased from System Biosciences Inc (Palo Alto ...
-
No products found
Monal Patel, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... or Zip-21 (LentimiRa-GFP-has-miR-21-5p vector, Applied Biological Materials #mh10276). Briefly ...
-
No products found
because this supplier's products are not listed.
Noushin Hadadi, et al.,
bioRxiv - Systems Biology 2019
Quote:
... and indexed with ScriptSeq™ Index PCR primers set 1 (Epicentre, Illumina) following the standard protocol ...
-
No products found
because this supplier's products are not listed.
Leonardo Lupori, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The primer sets used were Quick-16S™ Primer Set V3-V4 (Zymo Research). The sequencing library was prepared using an innovative library preparation process in which PCR reactions were performed in real-time PCR machines to control cycles and therefore limit PCR chimera formation ...
-
No products found
because this supplier's products are not listed.
Martins H.C., et al.,
bioRxiv - Neuroscience 2021
Quote:
Subjects used for miR-499-5p expression analysis on psychiatrically healthy controls (Control) or Bipolar disorder patients (BD). One-way-ANOVA was performed to evaluate significant differences between groups ...
-
No products found
because this supplier's products are not listed.
Cilia R Pothast, et al.,
bioRxiv - Immunology 2022
Quote:
... Smartseq2modified PCR primer (Eurogentec) and TRAC or TRBC1/2 specific primers (Eurogentec ...
-
No products found
because this supplier's products are not listed.
Alexandr Samocha, et al.,
bioRxiv - Cell Biology 2020
Quote:
... RT PCR was performed using the RealPlex2 (Eppendorf). Expression was normalized to ß-Actin (Mm02619580_g1 ...
-
No products found
because this supplier's products are not listed.
Erin A. Nekritz, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... MiRNA inhibition in MCF-10A cells was achieved by transducing cells with a miRNA inhibitor against hsa-miR-424-5p and hsa-miR-503-5p (Genecopoeia #HmiR-AN0494-AM03 and #HmiR-AN0550-AM03 respectively) ...
-
No products found
because this supplier's products are not listed.
Wei Yu, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Mouse positive control primer set Actb2 (#71017, Active Motif) and mouse negative control primer set 1 (#71011 ...
-
No products found
because this supplier's products are not listed.
Yumei Qin, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Genotypes were confirmed using primer sets recommended by Jackson Laboratory and Sinha lab.
-
No products found
because this supplier's products are not listed.
Katarzyna Goljanek-Whysall, et al.,
bioRxiv - Physiology 2019
Quote:
... with 100nM miR scrambled or miR-181a mimic (100nM; GE Healthcare) (Soriano-Arroquia et al. ...
-
No products found
because this supplier's products are not listed.
Pastor Jullian Fabres, et al.,
bioRxiv - Plant Biology 2021
Quote:
... RT-PCR products were purified using PCR Clean-up (Macherey-Nagel, 740609.250) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Shubhangini Tiwari, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The cDNA was obtained by RT-PCR and amplified through PCR using respective primers (OriGene Technologies) followed by agarose gel electrophoresis to assess the gene expression ...
-
No products found
because this supplier's products are not listed.
Huai-Chin Chiang, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and anti-ERα (Santa Cruz, sc-542, 1:500)
-
No products found
because this supplier's products are not listed.
Coralie Dessauges, et al.,
bioRxiv - Systems Biology 2022
Quote:
... The following primers were used for the RT-qPCR reaction (designed with the Real-time PCR (TaqMan) Primer and Probes Design Tool from GenScript).
-
No products found
because this supplier's products are not listed.
Ekaterina S. Potekhina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... OneTube RT-PCR SYBR kit (Evrogen) was used for cDNA production by reverse transcription followed by qPCR ...
-
No products found
because this supplier's products are not listed.
Astrid Hoermann, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... RT-PCR was performed with RedTaq Polymerase (VWR) with primers 51-Scorpine-F and 117-CP-ctrl-R on Sco-CP (1267bp) ...
-
No products found
because this supplier's products are not listed.
Zhihua Liu, et al.,
bioRxiv - Microbiology 2020
Quote:
... Reverse transcription with ZIKA virus specific primer (Rev-AAGTGATCCATGTGATCAGTTGATCC) was performed using FastQuant RT Kit (Tiangen). Real-time PCR was done on 7900HT (ABI ...
-
No products found
because this supplier's products are not listed.
Christophe M. Capelle, et al.,
bioRxiv - Immunology 2021
Quote:
... the cells were fixed for 1 h at RT using the True-Nuclear transcription Factor Buffer Set (BioLegend, 424401). Following the fixation ...
-
No products found
because this supplier's products are not listed.
Krisztina Percze, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 130 of the colonies were analysed by colony PCR (using an M13 primer set, Table S1) and capillary electrophoresis (LabChip GX, PerkinElmer) using the DNA 1K Reagent Kit with DNA HT 5K LabChip single sipper chip ...
-
No products found
because this supplier's products are not listed.
Connor G. G. Bamford, et al.,
bioRxiv - Microbiology 2021
Quote:
... these were run as two separate multiplex PCR “pools” (A & B) using the ARTIC version 3 primer set (ARTIC nCoV-2019 V3 Panel, IDT DNA Inc ...
-
No products found
because this supplier's products are not listed.
F. Moos, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... FF01-542/27-25 (all from Semrock) and ZET405/488/561/640mv2 (Chroma Technologies). The fluorescence images are acquired using ORCA-Fusion sCMOS cameras (C14440-20UP ...
-
No products found
because this supplier's products are not listed.
Clay Conner, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... the cells were incubated with DAPI diluted in PBS for 10 min at RT and washed before being mounted onto slides with Vectashield Hard Set (Vector Laboratories). Single-planed images were taken on a Nikon C2 confocal microscope using a 40X oil-immersion lens ...
-
No products found
because this supplier's products are not listed.
Mügen Terzioglu, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Live-cell and time-lapse images of cells stained with MitoTrackerTM Deep Red FM or MTY (excitation 542 nm, emission 562 nm) were captured by laser-scanning microscopy (Nikon A1R), using a Nikon 60x/1.27 water-immersion (CFI SR Plan Apo IR 60XC WI ...
-
No products found
because this supplier's products are not listed.
Peng Wang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and phosphatase inhibitor cocktail set III (Calbiochem). Protein was quantified with Pierce BCA protein assay kit (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Jiuling Yang, et al.,
bioRxiv - Immunology 2024
Quote:
... with 5% Nu-Serum IV (Corning, cat. 80089-542), 5% Fetal Bovine Serum (Corning ...
-
No products found
because this supplier's products are not listed.
Justin X. Boeckman, et al.,
bioRxiv - Pathology 2021
Quote:
... Positive bands of appropriate size were confirmed using individual primer sets and resultant PCR products were visualized on a 1.5% agarose gel with gel red (Biotium).
-
No products found
because this supplier's products are not listed.
Erick X. Pérez-Guzmán, et al.,
bioRxiv - Microbiology 2019
Quote:
... and using DENV RT primer/probe Mix kit (Genesig, Primerdesign Ltd., UK) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Corinne A. Tovey, et al.,
bioRxiv - Cell Biology 2021
Quote:
... were synthesised either by PCR using two overlapping primers or by GENEWIZ. They were inserted into the linear backbone by HiFi Assembly (NEB) ...
-
No products found
because this supplier's products are not listed.
Teketel A. Haile, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Two allele specific forward primers and a reverse primer were designed for use in fluorescence based competitive allele-specific PCR assays (KASP; LGC Biosearch Technologies). DNA from the 286 lines was assayed using these primers and KASP reaction mix (LGC Biosearch Technologies ...
-
No products found
because this supplier's products are not listed.
Zahraa Alraies, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 562 and 506 nm dichroic mirrors and passed through 593/40 (mTom) and 542/27 (YFP) filters to nondescanned detectors (Olympus) and 483/32 (collagen by second harmonic generation ...
-
No products found
because this supplier's products are not listed.
Leonardo Augusto, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cloned IRE1-/- MEF cells were validated by RT-qPCR using specific primers and by immunoblot using IRE1-specific antibody (Abcam-ab37073). IRE1-/- cells were complemented with pcDNA3-derived vectors containing WT or the indicated mutant versions of IRE1 ...
-
No products found
because this supplier's products are not listed.
Aleksandr Alekseev, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Filter set 10 (Carl Zeiss) was used for separating the fluorescence and the excitation light ...
-
No products found
because this supplier's products are not listed.
Wataru Yamamoto, Rafael Yuste,
bioRxiv - Neuroscience 2019
Quote:
... equipped with a long-pass GFP filter set (Leica filter set ET GFP M205FA/M165FC), 1.63X Plan Apo objective ...