-
No products found
because this supplier's products are not listed.
Takehiro Takahashi, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a commercially available specific primer set was used (System Biosciences). For the detection of some other targets ...
-
No products found
because this supplier's products are not listed.
Zhi Yang, et al.,
bioRxiv - Bioengineering 2023
Quote:
... All qRT-PCR primers were ordered from Eton Bioscience. Quantitative real-time PCR was performed using the SYBR Green Mix (Cat# A25742 ...
-
No products found
because this supplier's products are not listed.
Habibie Habibie, et al.,
bioRxiv - Cell Biology 2023
Quote:
... CCL-206 murine lung fibroblasts were maintained in DMEM (GibcoTM) / Ham’s F12 medium (Lonza) supplemented with 10% fetal bovine serum (FBS) ...
-
No products found
because this supplier's products are not listed.
Corinne A. Tovey, et al.,
bioRxiv - Cell Biology 2021
Quote:
... were synthesised either by PCR using two overlapping primers or by GENEWIZ. They were inserted into the linear backbone by HiFi Assembly (NEB) ...
-
The Mouse Direct PCR Kit provides a fast preparation and PCR amplIFication that is specIFically...
Cat# B40013, SKU# B40013-200rxns,
200rxns, $127.00
Ask
Bo Zhang, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Then the cDNA was subjected to quantitative RT-PCR (qRT-PCR) using the SYBR green assay with 2× SYBR green qPCR master mix (Bimake). Thermal profile was 95 °C for 5 min and 40 cycles of 95 °C for 15 sec and 60 °C for 20 sec ...
-
No products found
because this supplier's products are not listed.
Jessica M. Salmon, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... separate PCRs were set up to generate the CITE-seq ADT library (SI-PCR and RPI-x primers) and the HTO library (SI-PCR and D7xx_s).
-
No products found
because this supplier's products are not listed.
Yvonne Giesecke, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Quantitative real-time human-specific primer sets for CyberGreen PCR amplifications were obtained from TIB Molbiol (Berlin, Germany). Primer sequences were:
-
No products found
because this supplier's products are not listed.
Anna-Leigh Brown, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and subsequently bead/size selection of RT/PCR products (TotalPure NGS, Omega Biotek). Three rounds of nested PCR using Phusion HF 2x Master Mix (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Debatosh Das, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Real-time RT-PCR was performed with the qPCR GreenMaster high ROX mix (Jena Bioscience, Germany) and primers shown in Table S1 ...
-
No products found
because this supplier's products are not listed.
Nishit Goradia, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and was directly used for quantitative PCR with SimpleChIP human CDKN1A promoter primers (Cell Signaling Technology, MA, US). ChIP-qPCR data were normalized to input DNA and presented as percentage of input ...
-
No products found
because this supplier's products are not listed.
Pablo Canales-Herrerias, et al.,
bioRxiv - Immunology 2023
Quote:
ELISA was performed using Mouse IgA ELISA Quantitation Set or Mouse IgG ELISA Quantitation Set (Bethyl Laboratories) according to the manufacturer’s protocol with minor modifications ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Rachael Dong, et al.,
bioRxiv - Genomics 2023
Quote:
... barcoded universal primers (barcoded universal F/R primers plate 96 v2, PacBio) were attached to the forward and reverse universal sequences in the amplicons from the first-round L-PCR ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Schott, et al.,
bioRxiv - Bioengineering 2024
Quote:
... samples were homogenized with TRIzol RT Reagent (Molecular Research Center, RT 111) and pulverized by mechanical compression ...
-
No products found
because this supplier's products are not listed.
Nazahiyah Ahmad Rodzli, et al.,
bioRxiv - Biophysics 2019
Quote:
... Crystallisation trials were set up using a Mosquito (TTP Labtech) liquid handling robot ...
-
No products found
because this supplier's products are not listed.
Alexander P. Ligocki, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and Z6040 embedding primer (EMS, Hatfield, PA) in increments of 3:1 ...
-
No products found
because this supplier's products are not listed.
Kevin Lin, et al.,
bioRxiv - Systems Biology 2023
Quote:
... and the Supplementary Primer Sets (Cellecta #LNGS-120-SP) to amplify the sgRNA and append Illumina sequencing adapters and index barcodes for each replicate sample ...
-
No products found
because this supplier's products are not listed.
Taihei Fujimori, et al.,
bioRxiv - Genetics 2023
Quote:
... or CUTANA™ CUT&RUN Library Prep Kit with Primer Set 1 (14-1001, EpiCypher), and library concentrations were quantified with the Qubit 1 X dsDNA HS Assay Kit (Q33231 ...
-
No products found
because this supplier's products are not listed.
Weirong Kang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... qRT-PCR primers were from Sino Biological (Wayne, PA) or Genetimes ExCell (Hong Kong) ...
-
No products found
because this supplier's products are not listed.
Haowen Qiao, et al.,
bioRxiv - Neuroscience 2022
Quote:
... RT-PCR was performed using SYBR Green Real-time PCR Master Mix (RK21203, ABclonal Technology) under the following reaction conditions (35 cycles) ...
-
No products found
because this supplier's products are not listed.
Alexander J. Garvin, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Clones were screened by PCR using primers that flank the SUMO4 gene using genomic DNA purified with direct PCR buffer (Viagen). Clones that displayed reduced size of SUMO4 PCR product were sequenced by Sanger sequencing to confirm disruption of the SUMO4 locus ...
-
No products found
because this supplier's products are not listed.
Brandon T. Sinn, et al.,
bioRxiv - Genomics 2021
Quote:
... reactions were set up in 10 μl volumes with: 5 μl 2×Apex PCR Master Mix (Genesee Scientific ...
-
No products found
because this supplier's products are not listed.
Kutubuddin A. Molla, Justin Shih, Yinong Yang,
bioRxiv - Plant Biology 2019
Quote:
... The target loci were amplified by PCR using specific primers (Supplementary Table 1) and resulting DNA fragments were purified with PCR purification kit (Bio Basic Inc, Canada). The wsl5 and zebra3 PCR product was digested with SacI and SalI ...
-
No products found
because this supplier's products are not listed.
Ana Cláudia Raposo, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Reverse Transcriptase quantitative PCR (RT-qPCR) was performed using NZYSpeedy qPCR Green Master Mix ROX (#MB22302, NZYTech) or NZYSpeedy qPCR Green Master Mix ROX Plus (#MB22202 ...
-
No products found
because this supplier's products are not listed.
Soumitra Ghosh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... ATAC-seq library preparation involved PCR amplification of the purified DNA fragments using Diagenode primer indices (Diagenode, Cat# C01011034). Amplification cycles were adjusted and libraries were purified using AMPure beads ...
-
No products found
because this supplier's products are not listed.
Jan Felix, et al.,
bioRxiv - Biochemistry 2019
Quote:
Crystallization trials were set up manually in a sitting drop vapour diffusion set-up using 24-well sitting drop plates (Hampton research) with drop volumes of 1 µl (0.5 µl protein solution + 0.5 µl reservoir solution) ...
-
No products found
because this supplier's products are not listed.
Veronika Mikhaylova, et al.,
bioRxiv - Genomics 2023
Quote:
... to remove primers plus one or two rounds of 0.41x HighPrep™ PCR Clean-up beads (Cat. #AC-60050; MagBio Genomics®) for 13 kb SCN10A amplicons ...
-
No products found
because this supplier's products are not listed.
Matthew R. Hannaford, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Acquisition was set up through the Metamorph software (Molecular Devices). Unless otherwise stated in the figure legend ...
-
No products found
because this supplier's products are not listed.
Jean Jacques Walker, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Phymep) set on a micro-syringe pump injector (UMP3 UltraMicroPump, WPI), 6-OHDA rats received 2.3 μL bilateral injections of 6-OHDA hydrobromide (6 μg combined with ascorbic acid dissolved in 2.3 μL sterile 0.9% NaCl ...
-
No products found
because this supplier's products are not listed.
Courtney Tindle, et al.,
bioRxiv - Immunology 2023
Quote:
... A custom primer panel was developed by Tecan Genomics ...
-
No products found
because this supplier's products are not listed.
Jeong-Su Park, et al.,
bioRxiv - Immunology 2022
Quote:
... and reverse-transcribed using RT-Premix (Intron Biotechnology). PCR was performed with the following primers (the respective forward and reverse pairs are indicated) ...
-
No products found
because this supplier's products are not listed.
Anisha P. Adke, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and left overnight to air-dry before coverslips were set using Fluoromount-G (SouthernBiotech). Representative high magnification images were collected using a Nikon A1R laser scanning confocal microscope and a 40x oil-immersion objective ...
-
No products found
because this supplier's products are not listed.
Virginia Andrade, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3 % milk at RT and revealed by LI-COR (Biosciences).
-
No products found
because this supplier's products are not listed.
Dollie LaJoie, et al.,
bioRxiv - Cell Biology 2022
Quote:
... chicken α-Tubulin (Synaptic systems; 302 206)] followed by AlexaFluor conjugated secondary antibodies (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Yoichiro Harada, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... was used as a template to amplify the MPI gene by PCR using a primer set (Supplementary Table S1) and the PCR products were cloned into pMXs-Neo retroviral expression vector (RTV-011, Cell Biolabs) to yield pMXs-Neo-hMPI by using In-Fusion HD Cloning Kit (639648 ...
-
No products found
because this supplier's products are not listed.
Inés García-Rodríguez, et al.,
bioRxiv - Microbiology 2023
Quote:
Dorsal forebrain regionalized neural organoids (RNOs) were generated using the STEMDiff™ Dorsal Forebrain Organoid Differentiation Kit (STEMCELL Technologies™) and STEMDiff™ Neural Organoid Maintenance Kit (STEMCELL Technologies™ ...
-
No products found
because this supplier's products are not listed.
Enxhi Shaba, et al.,
bioRxiv - Cell Biology 2023
Quote:
... The HEK293T cells (mycoplasma-free, verified by N-GARDE Mycoplasma PCR reagent set, Euroclone) were maintained in Dulbecco’s modified Eagle’s Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
J. Martinez-Fabregas, et al.,
bioRxiv - Immunology 2020
Quote:
... Agencourt AMPure XP beads and PCR amplified using KAPA hot start High-Fidelity 2X PCR Master Mix and NextFlex index primers (Bioo Scientific, PerkinElmer) for 12 cycle by following thermocycler cycles ...
-
No products found
because this supplier's products are not listed.
Takenori Kanai, et al.,
bioRxiv - Cell Biology 2019
Quote:
... The RT-PCR products were separated on 2% agarose gel (NuSieve; FMC, Rockland, ME, USA) and visualized by Syber Green (Takara) ...
-
No products found
because this supplier's products are not listed.
C. E. McGonigle, C. C. Lapish, M. L. Logrip,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
Three separate cohorts of adult male and female Wistar rats (initial weights M: 253-306 g; F: 146-206 g Charles River, NC) were obtained at 8 weeks of age ...
-
No products found
because this supplier's products are not listed.
Sushama Telwatte, et al.,
bioRxiv - Microbiology 2021
Quote:
... The log-linear relationship between viral load measured by RT-PCR (Abbott Real Time SARS-CoV-2 assay) and RT-ddPCR was determined using GraphPad Prism (version 8.4.1).
-
No products found
because this supplier's products are not listed.
Daniele Merico, et al.,
bioRxiv - Genetics 2019
Quote:
... PCR was performed with primers P243 and P472 and separated on 2% agarose gels stained with 0.05% Redsafe (FroggaBio). See Supplementary Dataset 1 for primer sequences.
-
No products found
because this supplier's products are not listed.
Tomoya Eguchi, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... set on an OctoMACS separator (Miltenyi Biotec) and equilibrated with 0.5% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Minae Yoshida, Dean Willis,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... with random primers (Invivogen). 2 μg of total RNA were used per construct.
-
No products found
because this supplier's products are not listed.
Luca Barberi, et al.,
bioRxiv - Biophysics 2020
Quote:
... a Quantum GIF energy filter (Gatan, slit width set to 20eV) and a Volta Phase Plate (VPP) ...
-
No products found
because this supplier's products are not listed.
Ryan Scott Wilkins, et al.,
bioRxiv - Biochemistry 2024
Quote:
From a set of four commercial crystallization screens from Molecular Dimensions multiple hits were identified for BpCM when screened at 1 mM ...
-
No products found
because this supplier's products are not listed.
Abeer Al-Zubaidi, et al.,
bioRxiv - Microbiology 2021
Quote:
... All assays were set up in 96 well plates (Greiner Bio-One) in a total volume of 100μL where 50μL of the diluted culture was added to 50μL of two-fold serially diluted antibiotics in Middlebrook 7H9 media ...
-
No products found
because this supplier's products are not listed.
Michael Wainberg, et al.,
bioRxiv - Genomics 2019
Quote:
... DMS compensation voltages were tuned using a set of lipid standards (SCIEX, cat#: 5040141), and a quick system suitability test (QSST ...
-
No products found
because this supplier's products are not listed.
Gopal Kushawah, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... PCR products were purified using Favorprep Gel/PCR purification kit (Favorgen) columns or PCR purification kit (QIAgene ...
-
No products found
because this supplier's products are not listed.
Line Jensen Ostenfeld, et al.,
bioRxiv - Microbiology 2022
Quote:
45μl PCR product was purified with Gene Clean Turbo for PCR kit (MP Biomedicals) according to the manufacturer’s instructions ...