-
No products found
because this supplier's products are not listed.
Yahan Wei, Camille I. Sturges, Kelli L. Palmer,
bioRxiv - Microbiology 2022
Quote:
... and analyzed with the MyGo Pro PCR Software (v3.2, Azura Genomics). Relative transcript levels of the target genes were calculated with the ΔΔCt method with normalization to the Ct numbers of 16S rRNA ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Fatima Amer-Sarsour, et al.,
bioRxiv - Cell Biology 2022
Quote:
... rabbit anti-α-Fetoprotein (ScyTek A00058); rabbit anti-α-smooth muscle actin (Abcam 32575) ...
-
No products found
because this supplier's products are not listed.
Jean-Marc Aury, et al.,
bioRxiv - Genomics 2022
Quote:
... 3’-adenylated and Illumina adapters (Bioo Scientific, Austin, TX, USA) were then added using the Kapa Hyper Prep Kit (KapaBiosystems ...
-
No products found
because this supplier's products are not listed.
Alexis S. Zajicek, et al.,
bioRxiv - Neuroscience 2021
Quote:
... blots were stripped between probes with Membrane Stripping Buffer-3 (Boston BioProducts). Signals were detected using SuperSignal West Femto Maximum Sensitivity Substrate Kit (Pierce ...
-
No products found
because this supplier's products are not listed.
Dalia Rosano, et al.,
bioRxiv - Cancer Biology 2021
Quote:
CloneTracker XP 10M Barcode-3’ Library with RFP-Puro (BCXP10M3RP-P) was purchased from Cellecta. Production of lentiviral particles and MCF7 transduction was performed following CloneTracker™ XP Lentiviral Expressed Barcode Libraries online manual (https://manuals.cellecta.com/clonetracker-xp-lentiviral-barcode-libraries/) ...
-
No products found
because this supplier's products are not listed.
Huanan Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... was purchased from Assay Pro, USA ...
-
Recombinant Human Pro-BDNF Protein is produced by E. coli. It is a single non-glycosylated...
Cat# CRP1114,
10 ug USD $140.0, 50 ug USD $420.0, 500 ug USD $2100.0
Ask
Tiong Kit Tan, et al.,
bioRxiv - Immunology 2020
Quote:
... IgG-Alexa Fluor-647 mAb (Cohesion Biosciences, Generon,), IgA-FITC polyclonal Ab (BioRad Antibodies ...
-
No products found
because this supplier's products are not listed.
Lindsey R. Conroy, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Recombinant PNGaseF Prime was obtained from Bulldog Bio, Inc ...
-
No products found
because this supplier's products are not listed.
Dominik P. Elmer, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Production of lentiviral particles by 293FT cells using metafectene pro (Biontex Laboratories, Munich, Germany) and transduction of melanoma cells was performed following the protocol described in [66] ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Xiaowei Sun, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Recombinant human insulin (M9194) was purchased from AbMole (Houston, USA). The ARF1 inhibitor Golgicide A (HY-100540 ...
-
No products found
because this supplier's products are not listed.
Shivanand Hegde, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 min 3% bleach+0.01% Coverage Plus NPD (Steris Corp.), 5 min in 70% ethanol then rinsed three times in sterile water ...
-
No products found
because this supplier's products are not listed.
Junfeng Shi, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4h post 1.4Gy total body irradiation using the RS2000 Pro irradiator (Rad Source, Buford, GA, USA). The engraftment levels of hCD45+ cells were determined 12 weeks post-HPSCs transplantation by flow cytometric quantification of peripheral blood human CD45+ cells ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Godeux, et al.,
bioRxiv - Microbiology 2021
Quote:
... Suspension were plated on LB agar plates without antibiotics and LB agar plates containing rifampicin (100 µg/mL) and imipenem (1.6 µg/mL) either with beads or easySpiral Pro (Interscience). Recombinants frequencies were determined through calculation of the ratio of the number of CFUs on rifampicin and imipenem plates ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
María Belén Palma, et al.,
bioRxiv - Cancer Biology 2021
Quote:
WB analysis was performed to assess the expression of the HLA-G protein in RCC7/HLA-G1 after transfection of the CRISPR/Cas9 system by using the 4H84 mAb (Exbio) at a 1:1000 dilution ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Alejandro M. Gomez, et al.,
bioRxiv - Immunology 2023
Quote:
... was induced by retro-orbital injection of a cocktail of 5 monoclonal antibodies (mAbs) against mouse collagen type II (anti-CII cocktail, Chondrex Inc), followed by intraperitoneal injection of lipopolysaccharide (LPS ...
-
No products found
because this supplier's products are not listed.
Manuel V. Borca, et al.,
bioRxiv - Microbiology 2019
Quote:
... Recombinant transfer vector p72mCheryΔI177L was obtained by DNA synthesis (Epoch Life Sciences Missouri City, TX, USA).
-
No products found
because this supplier's products are not listed.
Young Sun Hwang, M. Andrés Blanco, Kotaro Sasaki,
bioRxiv - Developmental Biology 2022
Quote:
... hiPSCs were cultured on plates coated with recombinant laminin-511 E8 (iMatrix-511 Silk, Nacalai USA) and maintained under feeder-free conditions in StemFit® Basic04 medium (Ajinomoto ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
Protein
Cat# PIC60100,
100µL + 100µL R-PHYCO, USD $171.00/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Dong Hun Lee, et al.,
bioRxiv - Physiology 2022
Quote:
Human pulmonary artery endothelial cells HPAEC (3 × 105/well) derived from 3 separate individuals were cultured in 6 well plates with ECM media (ScienCell, Carlsbad, CA) then treated with TGF-β (10 ng/ml) ...
-
No products found
because this supplier's products are not listed.
Jonathan D Teo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Six distinct fields of view per mouse were imaged at 15,000x magnification and captured as 3×3 tile scans using the JEOL integrated software and a high-sensitivity sCMOS camera (JEOL Matataki Flash). G-ratios were calculated as the diameter of the axon lumen divided by the diameter of the lumen plus myelin sheath (Song et al. ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Huilei Wang, et al.,
bioRxiv - Physiology 2023
Quote:
... COLIV rabbit polyclonal (Assay Biotech C0157), beta Actin Loading Control Monoclonal Antibody (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Daniel Kirchmeier, et al.,
bioRxiv - Immunology 2023
Quote:
... rabbit α-CD3 (SP7, Diagnostic Biosystem), rabbit α–human CD103 (EPR4166(2) ...
-
No products found
because this supplier's products are not listed.
Georgi K. Marinov, et al.,
bioRxiv - Genomics 2021
Quote:
... 1 µL of each synthetic sgRNA were incubated at room temperature with 1 µL of recombinant purified dCas9 (MCLab dCAS9B-200) for 20 minutes ...
-
No products found
because this supplier's products are not listed.
James T. McKenna, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#7001KH, Point Style 3, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Siyuan Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (3) Spin-coating SU-8 precursor (SU-8 2000.5, MicroChem) at 3000 rpm ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Haley E. Mudrick, et al.,
bioRxiv - Immunology 2021
Quote:
... and Rabbit Anti-Hamster IgA (Brookwood Biomedical). For mouse samples ...
-
No products found
because this supplier's products are not listed.
Stefanie Lübke, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... rabbit anti-β -Gal 1:5000 (Biotrend), rabbit anti-GFP 1:500 (abcam) ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Gonzalo Sanchez, et al.,
bioRxiv - Cell Biology 2021
Quote:
... IFT88 (F41236 NSJ Bioreagents, host: rabbit, 1:200), SSTR3 (E-AB-1607 Elabscience ...
-
No products found
because this supplier's products are not listed.
Ningke Hou, et al.,
bioRxiv - Microbiology 2019
Quote:
... SSP4 (3’,6’-Di(O-thiosalicyl)fluorecein) was purchased from DOJINDO MOLECULAR TECHNOLOGIES (Bibli et al ...
-
Fmoc-Pro-Pro-Pro-Pro-Pro-OH is a potential building block for polyproline-based chiral stationary phases.
Cat# 454693-94-8,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Alexandria J. Hammond, et al.,
bioRxiv - Microbiology 2020
Quote:
... Bacteria were stained with rabbit anti-capsule (Type 4 (Statens Serum Institut, 16747) and Type 23F serum (Statens Serum Institut ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Florencia Rago, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cells were treated with BRM011, BRM014, or BRM017 (11-point, 3-fold serial dilutions) in triplicate using an Echo550 (Labcyte). Viability was assessed on Day 0 and Day 5 using CTG according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Dani Flinkman, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and filtered through Whatman Grade 3 filter material and cleaned-up with C18-UltraMicroSpin columns (The Nest Group, Inc., Southborough, USA). The peptides were then dried and dissolved in 0.1 % Formic acid (FA) ...