1 - 50 of 299
suppliers found for
mmu mir 212 3p RT PCR Primer Set
» view 10000+ matched products-
Cohesion Biosciences Sponsored
Stem-loop RT primer and PCR primer set to detect mature miRNA mmu-mir-212-3p expression.Cat# CPK3298, 1 nmol USD $100.0 Ask
-
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... 100nM of miR-24-3p inhibitor (Anti-mmu-miR-24-3p, Qiagen, MIN0000219), 100nM of scrambled control (AllStars Negative Control siRNA Print ... -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: MirVana™ miR-212-3p Mimic and scramble negative control were purchased from ThermoFisher Scientific ... -
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... Standard RT-PCR using independent sets of Predesigned KiCqStart® SYBR® Green Primers (Sigma, Table S11) was carried out for validation with independent biological replicates from 2D cultures (n = 2 ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2018Quote: ... Prime PCR primer sets were purchased from Bio-Rad. Expression results were calculated by ΔΔCT method and were normalized to the reference genes GAPDH and βActin. -
American BioInnovations,
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... mmu-miR-124-3p mirVana® miRNA mimic (#4464066, MC10691, ABI), siFus#1 (mouse Fus siRNA) ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2017, published in Cell Reports doi: 10.1016/j.celrep.2018.03.059Quote: ... the complementary seed sequence for miR-212/132 was cloned into pmirGLO (Promega) into PmeI/XbaI sites by oligo hybridization (see below) ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... real-time RT-PCR was performed with SARS-CoV-2 N primer sets and SYBR Premix Ex Taq II (TaKaRa-Bio) using a LightCycler Nano (Roche ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... Primer Set 1 (New England Biolabs). Libraries were sequenced on an Illumina HiSeq 2500 instrument using 50-bp single-end reads. -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Systems Biology 2019, published in npj Systems Biology and Applications doi: 10.1038/s41540-019-0121-4Quote: ... and indexed with ScriptSeq™ Index PCR primers set 1 (Epicentre, Illumina) following the standard protocol ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2022Quote: ... Primer sets were designed using ProbeFinder (Roche) and Primer 3 softwares and can be seen as Supporting Information (Table S1) ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: ... Mycoplasma Plus PCR Primer Set (Agilent) was used to determine mycoplasma for all cell lines ... -
Mirus Bio
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2022Quote: Murine neonatal cardiomyocytes and NHDFs were transfected with miR-146a-5p, miR-126-3p and miR-370-3p mimics (Lightswitch, 100nM final concentration) using Trans-IT TKO (Mirus) in their respective serum free growth media ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... pLVX-anti-MIR328-3p (Addgene #153319), and pLVX-Che-zsGreen (Addgene #153320 ... -
Bioline
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... RT-PCR reactions were set up in a 384-well format using 2X SensiFAST Probe No-ROX Kit (Bioline, BIO-86005) and 1 µl of cDNA per reaction in a total volume of 10 µl ... -
Applied Biological Materials
No products foundbioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ... -
Eurogentec
No products found because this supplier's products are not listed.Cited in Isolation of nucleic acids from low biomass samples: detection and removal of sRNA contaminantsbioRxiv - Molecular Biology 2018, published in BMC Biology doi: 10.1186/s12915-018-0522-7Quote: ... the aqueous phase was spiked with synthetic hsa-miR-486-3p RNA (Eurogentec) to yield 40,000 copies per μl eluate ... -
Lucigen
No products found because this supplier's products are not listed.bioRxiv - Systems Biology 2019, published in npj Systems Biology and Applications doi: 10.1038/s41540-019-0121-4Quote: ... and indexed with ScriptSeq™ Index PCR primers set 1 (Epicentre, Illumina) following the standard protocol ... -
Beckman
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: ... and NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1 E7335S, Index Primers Set 2, E7500S) with Agencourt AMPure XP magnetic beads (Beckman coulter A63881) exactly as per manufacturer’s instructions ... -
Zymo Research
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... The primer sets used were Quick-16S™ Primer Set V3-V4 (Zymo Research). The sequencing library was prepared using an innovative library preparation process in which PCR reactions were performed in real-time PCR machines to control cycles and therefore limit PCR chimera formation ... -
Eppendorf
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... RT PCR was performed using the RealPlex2 (Eppendorf). Expression was normalized to ß-Actin (Mm02619580_g1 ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2022Quote: ... Genotypes were confirmed using primer sets recommended by Jackson Laboratory and Sinha lab. -
R&D Systems
No products found because this supplier's products are not listed.Cited in Partial FMRP expression is sufficient to normalize neuronal hyperactivity in Fragile X neuronsbioRxiv - Neuroscience 2019, published in European Journal of Neuroscience doi: 10.1111/ejn.14660Quote: ... and rhGDNF (R&D Systems, 212-GD)) ... -
Macherey-Nagel GmbH
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2021Quote: ... RT-PCR products were purified using PCR Clean-up (Macherey-Nagel, 740609.250) following the manufacturer’s instructions ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ... -
Research Products International
No products found because this supplier's products are not listed.bioRxiv - Genomics 2018Quote: ... separate PCR reactions were set up to generate the ADT library (SI-PCR and RPI-x primers), the hashtag library (SI-PCR and D7xx_s ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2018Quote: ... 40 ng/ml IL-2 (Peprotech, 212-12) and 10 ng/ml TGFb (RnD systems ... -
IDT DNA
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... these were run as two separate multiplex PCR “pools” (A & B) using the ARTIC version 3 primer set (ARTIC nCoV-2019 V3 Panel, IDT DNA Inc ... -
GenScript
No products found because this supplier's products are not listed.Cited in Optogenetic actuator/ERK biosensor circuits identify MAPK network nodes that shape ERK dynamicsbioRxiv - Systems Biology 2022Quote: ... The following primers were used for the RT-qPCR reaction (designed with the Real-time PCR (TaqMan) Primer and Probes Design Tool from GenScript). -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019, published in Aging Cell doi: 10.1111/acel.13140Quote: ... with 100nM miR scrambled or miR-181a mimic (100nM; GE Healthcare) (Soriano-Arroquia et al. ... -
Origene Technologies
No products found because this supplier's products are not listed.Cited in A mean-field approach for modeling the propagation of perturbations in biochemical reaction networksbioRxiv - Pharmacology and Toxicology 2021Quote: ... Chop mRNA levels in treated cells were measured using quantitative RT-PCR as previously described [28] using validated primers (OriGene, Cat # HP207450). -
VWR
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Urine was sterilized with a 0.22 μm filter (VWR 29186-212) and pH was normalized to 6.0-6.5 ... -
Evrogen
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2017, published in PLOS ONE doi: 10.1371/journal.pone.0184507Quote: Oligonucleotide primers for DOP-PCR and iDOP-PCR were synthesized by Evrogen JSC (Moscow ... -
TianGen Biotech
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... Reverse transcription with ZIKA virus specific primer (Rev-AAGTGATCCATGTGATCAGTTGATCC) was performed using FastQuant RT Kit (Tiangen). Real-time PCR was done on 7900HT (ABI ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... the cells were fixed for 1 h at RT using the True-Nuclear transcription Factor Buffer Set (BioLegend, 424401). Following the fixation ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ... -
Calbiochem
No products found because this supplier's products are not listed.Cited in A role for RNA and DNA:RNA hybrids in the modulation of DNA repair by homologous recombinationbioRxiv - Cell Biology 2018Quote: ... protease inhibitor cocktail set III (Calbiochem) and Benzonase 1:1000 (Sigma ... -
Active Motif
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2020Quote: ... Mouse positive control primer set Actb2 (#71017, Active Motif) and mouse negative control primer set 1 (#71011 ... -
Biotium Inc.
No products found because this supplier's products are not listed.bioRxiv - Pathology 2021Quote: ... Positive bands of appropriate size were confirmed using individual primer sets and resultant PCR products were visualized on a 1.5% agarose gel with gel red (Biotium). -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2019Quote: ... MART1and PFK transcripts were analyzed by SYBR Green–based real-time quantitative RT-PCR (qRT-PCR) using specific primers purchased from Santa Cruz. Data were normalized to the expression of RPL19 and are expressed as fold changes. -
Primerdesign
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in Nature Communications doi: 10.1038/s41467-019-12295-2Quote: ... and using DENV RT primer/probe Mix kit (Genesig, Primerdesign Ltd., UK) according to the manufacturer’s protocol ... -
GeneCopoeia
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... and miR-181c (“miR-181c OE”; Cat# AA08-MmiR3275-MR14-200, GeneCopoeia Inc, MD, USA) were packaged into a hepatocyte specific serotype ... -
Biosearch Technologies
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... Two allele specific forward primers and a reverse primer were designed for use in fluorescence based competitive allele-specific PCR assays (KASP; LGC Biosearch Technologies). DNA from the 286 lines was assayed using these primers and KASP reaction mix (LGC Biosearch Technologies ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in Scientific Reports doi: 10.1038/s41598-020-60269-yQuote: ... the cells were incubated with DAPI diluted in PBS for 10 min at RT and washed before being mounted onto slides with Vectashield Hard Set (Vector Laboratories). Single-planed images were taken on a Nikon C2 confocal microscope using a 40X oil-immersion lens ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019Quote: ... The RT-PCR were performed using AmpliTaq Gold DNA polymerase (Perkin Elmer, Boston, USA). PCR fragments were separated with electrophoresis using 1% agarose gel in tris-borate-EDTA (TBE ... -
Olympus
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... Filter sets from Olympus and Chroma Technology Corp (49309 ET – Orange#2 FISH and 49310 ET – Red#2 FISH ... -
Nikon
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2022Quote: ... and corresponding filter sets (Nikon). Imaging conditions were optimized for each sample ... -
Carl Zeiss
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2022Quote: ... Filter set 10 (Carl Zeiss) was used for separating the fluorescence and the excitation light ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... equipped with a long-pass GFP filter set (Leica filter set ET GFP M205FA/M165FC), 1.63X Plan Apo objective ... -
Chroma Technology
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2017, published in ACS Nano doi: 10.1021/acsnano.7b04743Quote: ... Fluorescence filter sets from Chroma Technology and Semrock were used ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020, published in mBio doi: 10.1128/mBio.00915-20Quote: ... Cloned IRE1-/- MEF cells were validated by RT-qPCR using specific primers and by immunoblot using IRE1-specific antibody (Abcam-ab37073). IRE1-/- cells were complemented with pcDNA3-derived vectors containing WT or the indicated mutant versions of IRE1 ...