-
No products found
because this supplier's products are not listed.
Francisco J. Calero-Cuenca, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Reverse transcription quantitative PCR (RT-qPCR) was performed using Power SYBR Green PCR MasterMix (Alfagene) according to the manufacturer’s instructions and using primers forward and reverse at 0,25 μM (final concentration ...
-
No products found
because this supplier's products are not listed.
Fynn M. Hansen, et al.,
bioRxiv - Systems Biology 2020
Quote:
HEK293 (human, DMSZ, ACC 635) and U2OS (human, American Type Culture Collection [ATCC], HTB-96) cell were cultivated in DMEM (Gibco ...
-
No products found
because this supplier's products are not listed.
William N. Voss, et al.,
bioRxiv - Immunology 2024
Quote:
... resuspended in a one-step RT-PCR solution with an overlap extension VH and VL primer set as previously described,6 emulsified using a dispersion tube (IKA), and subjected to overlap-extension RT-PCR under the following conditions ...
-
No products found
because this supplier's products are not listed.
Susan Paton, et al.,
bioRxiv - Microbiology 2021
Quote:
... RT-PCR was performed using the VIASURE SARS-CoV-2 Real Time PCR Detection Kit (Viasure; CerTest Biotec, Zaragoza, Spain), following the methods provided ...
-
No products found
because this supplier's products are not listed.
Fenglei Li, et al.,
bioRxiv - Immunology 2023
Quote:
... 106 T cells suspended in HBS/HSA were introduced into heated FCS2 flow chambers (Bioptechs) and allowed to interact with T22-containing SLBs as for intracellular Ca2+-imaging ...
-
Cat# HY-103684-1 mg,
1 mg, USD $350.0
Ask
Gege Yuan, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Set thalidomide (MedChemExpress, HY-14658) experimental groups (5 μM,10 μM ...
-
No products found
because this supplier's products are not listed.
Aisha A. AlJanahi, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... supplemented with 1% HSA (Baxter) and cytokines (SCF 100ng/mL, FLT3L 100ng/mL and TPO 100ng/mL; all from PeproTech)55 ...
-
No products found
because this supplier's products are not listed.
Iuliia Polina, et al.,
bioRxiv - Cell Biology 2023
Quote:
... containing 0.35% (w/v) human serum albumin (HSA) 0.35% (w/v), and prostaglandin I2 (PGI2, 0.5 μM) (Cayman Chemical, Ann Arbor, Michigan). Platelets were immobilized on the glass bottom plates (Cellvis Mountain View ...
-
No products found
because this supplier's products are not listed.
Regina Tkach, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Oligonucleotide primers provided by Lumiprobe RUS Ltd are listed in Table S1 SD.
-
No products found
because this supplier's products are not listed.
Jimin Yoon, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Cells were grown to confluency and then screened based on functional testing of the XBP1s construct using RT-PCR (described below) with or without 2 μg/mL doxycycline (dox; Alfa Aesar). The selected SupT1 single colony cell line encoding tetracycline-inducible XBP1s was then transduced with lentivirus encoding DHFR.ATF6(1–373 ...
-
No products found
because this supplier's products are not listed.
Meg A. Younger, et al.,
bioRxiv - Neuroscience 2022
Quote:
... a 1 mL Dounce tissue grinder and pestle set (Wheaton 357538) that had been autoclaved at 121°C for 4 hr the previous day was pre-wetted with homogenization buffer ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... set in a size 0 silicone cork (7752-15, Cole-Parmer, USA) in a 20 × 125 mm glass reactor tube (9826 ...
-
No products found
because this supplier's products are not listed.
Pedro Sampaio, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... a set of two motorized axis manipulators (MPC-385-2, Sutter Instruments) placed on both sides of a culture dish for moving pipettes to the desired positions ...
-
No products found
because this supplier's products are not listed.
Joseph L. Basalla, et al.,
bioRxiv - Biochemistry 2023
Quote:
Samples for imaging were set up in 16 well CultureWells (Grace BioLabs). Wells were passivated by overnight incubation in 5% (w/v ...
-
No products found
because this supplier's products are not listed.
Sean K. Ryan, et al.,
bioRxiv - Pathology 2019
Quote:
... RT cocktail consists of: 50mM Tris (Amresco J837) pH 7.8 ...
-
No products found
because this supplier's products are not listed.
Molly Brady, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a NIRF filter set (Semrock ICG-B, IDEX Health & Science LLC Rochester NY) and camera (Prosilica GT1380 ...
-
No products found
because this supplier's products are not listed.
François Mallard, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... and took the set maximizing the difference in median Integrated Complete-data Likelihood (ICL) between control groups (log area ...
-
No products found
because this supplier's products are not listed.
Isabella Joubert, et al.,
bioRxiv - Immunology 2019
Quote:
... cell fixation and permeabilization was performed using the FoxP3 Staining Buffer Sets (Tonbo Biosciences) according to the manufacturer’s instructions and 10% naïve mouse serum (in permeabilization buffer ...
-
No products found
because this supplier's products are not listed.
George C. Russell, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... Purified RNA was treated with RTS DNase (Cambio, Cambridge, UK) before cDNA synthesis.
-
No products found
because this supplier's products are not listed.
Jose Sandoval, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... and loaded onto sets of Octet RED 384 SSA biosensors (Pall ForteBio LLC., Menlo Park, CA) to density of 12 nm followed by blocking of non-occupied streptavidin residues of biosensors with 200 u biotin ...
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Gen Honda, et al.,
bioRxiv - Biophysics 2020
Quote:
... Prepared SU-8 and glass substrates were set at the bottom of φ35 mm culture dish (MatTek) using a 9 × 9 mm2 frame seal (SLF0201 ...
-
No products found
because this supplier's products are not listed.
Yun Huang, et al.,
bioRxiv - Biophysics 2023
Quote:
... The temperature was then set to 30 °C and protein expression was induced by adding 0.2 % arabinose (Goldbio). Cells were grown for additional 16 hours ...
-
No products found
because this supplier's products are not listed.
Marina E. Garrett, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Vital signs were monitored with a Physiosuite (model # PS-MSTAT-RT; Kent Scientific). Eye drops (Lacri-Lube Lubricant Eye Ointment ...
-
No products found
because this supplier's products are not listed.
Daniel Nichol, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... Sequencing of the SHV gene was performed using M13 primers (MCLab, Harbor Way, CA).
-
No products found
because this supplier's products are not listed.
Elizaveta O. Boldinova, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Primer-18 was 5′-labeled with [γ-32P]-ATP by T4 polynucleotide kinase (SibEnzyme, Russia) and annealed to the corresponding unlabeled Template-55 at a molar ratio of 1:1.1 ...
-
No products found
because this supplier's products are not listed.
Mika Moriwaki, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... A second set of ovaries was imaged using N-terminal eIF4ENIF1 rabbit antibody for comparison (2 μg/ml, NBP1-89389, Novus Biologicals, Littleton, CO). Slides were incubated in anti-mouse Alexa Fluor 488 and anti-rabbit Alexa Fluor 594 (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Jingyu Diao, et al.,
bioRxiv - Microbiology 2020
Quote:
... The reaction was quenched after 60 minutes at RT with 0.5 μL of 4.8% Lauryl Dimethylamine-N-Oxide (Anatrace), followed by addition of 6 μL Detection Solution ...
-
No products found
because this supplier's products are not listed.
Sara Meril, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 10μM forward and reverse primers (see Table 1) and 5μL of AzuraView GreenFast qPCR Blue Mix LR (Azura Genomics, AZ2305). Data was analyzed using QuantStudio 5 software (Thermo-Scientific) ...
-
No products found
because this supplier's products are not listed.
Clara Sidor, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... was amplified by PCR from the mNeonGreen vector (Allele Biotechnology), with the exclusion of the stop codon and the addition of a C-terminal linker.
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... To fabricate the silver ring electrodes a silver wire (ø: 635 μm; A-M Systems, WA., USA) was cut into pieces of 1 cm length and one end was curved and welded to form a close loop ...
-
No products found
because this supplier's products are not listed.
Adrian T. Press, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 1,2-Dipalmitoyl-sn-glycerol-3-phosphoethanolamine (DPPE) azide was conjugated to DY-635-alkin (Dyomics GmbH, Jena, Germany) and used to prepare liposomes using a 100 nm extruder ...
-
No products found
because this supplier's products are not listed.
Jun Cao, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... three sets of E20 and three sets of 6M rat heart RNA (Zyagen) were used ...
-
No products found
because this supplier's products are not listed.
Joseph H. Chapman, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The plate was sealed with Avant ThermalSeal optically clear polyester RT-PCR film (MIDSCI TS-RT2-100), briefly spun down ...
-
No products found
because this supplier's products are not listed.
Nathan Singh, et al.,
bioRxiv - Immunology 2019
Quote:
... and perforin (antibody sets from MABTECH), using ELISA substrate ADHP from Cayman Chemical ...
-
No products found
because this supplier's products are not listed.
Preeti Verma, et al.,
bioRxiv - Biophysics 2024
Quote:
... another set of reaction was set up wherein 5U of endo-(1,4)-β-glucanase (E-CELTR; Megazyme) was added at the beginning of the synthesis reaction for the enzymatic degradations of the in vitro synthesized glucan ...
-
No products found
because this supplier's products are not listed.
Xanthe A.M.H. van Dierendonck, et al.,
bioRxiv - Physiology 2019
Quote:
... NEFAs (NEFA-HR set R1, R2 and standard, WAKO Diagnostics, Instruchemie ...
-
No products found
because this supplier's products are not listed.
Mikael Lundqvist, et al.,
bioRxiv - Neuroscience 2022
Quote:
... a new set of acute electrode pairs (tungsten, epoxy-coated, FHC) was lowered through a grid ...
-
No products found
because this supplier's products are not listed.
Suheda Erener, et al.,
bioRxiv - Physiology 2019
Quote:
... C57BL/6 wild-type littermates and miR-216a KO mice were fed a 60% HFD diet (D12492i, Research Diets, Cedarlane, Burlington, Canada) starting at 6-8 weeks of age for 8 weeks ...
-
No products found
because this supplier's products are not listed.
Christelle Damon-Soubeyrand, et al.,
bioRxiv - Developmental Biology 2022
Quote:
Ultramicroscopy data sets were uploaded to IMARIS version 9.7 (Bitplane, Oxford Instruments England). The stacks were converted to IMARIS files (.ims ...
-
No products found
because this supplier's products are not listed.
Laurin Heinrich, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and segmented using the CODEX Processor set at default manufacturer values (Akoya Biosciences, 2021b). Final data were then viewed using the CODEX Multiplex Analysis Viewer (MAV ...
-
No products found
because this supplier's products are not listed.
Logan K. Smith, Kareem Fawaz, Bebhinn Treanor,
bioRxiv - Immunology 2020
Quote:
... Fluorescence intensity was converted into molecular count using a fluorescence standard38 (Quantitation set, Bangs Laboratories).
-
No products found
because this supplier's products are not listed.
Johanna Hol Fosse, et al.,
bioRxiv - Microbiology 2023
Quote:
... treated with blocking buffer (Background sniper, Biocare Medical, 30 min, RT), incubated with mouse IgG1 specific to ISAV HE (clone 3H6F8 [52] ...
-
No products found
because this supplier's products are not listed.
Olga Gewartowska, et al.,
bioRxiv - Genetics 2020
Quote:
... and secondary goat anti-rabbit HRP conjugated antibody (Agrisera, AS101069; 1 h, RT) was performed in antibody dilution buffer (1% BSA ...
-
No products found
because this supplier's products are not listed.
Valeria Scagliotti, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... samples were incubated at room temperature (RT) with Histoclear II (National Diagnostics, HS202) (2 x 20 minutes for E9.5-E11.5 and postnatal pituitaries ...
-
No products found
because this supplier's products are not listed.
Kie Kumaishi, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and 1 μM blocking primers (mPNA and pPNA, PNA BIO, Inc., Newbury Park, CA). PCR was performed using the following specifications ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
Seesandra V. Rajagopala, et al.,
bioRxiv - Genomics 2022
Quote:
... and 7.25 μl PCR Certified Water (Teknova). RNA was reverse transcribed at 50ºC for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Robert Hardt, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Blots were washed thrice with TBS-T and incubated with one of the following secondary antibodies for 1 h at RT: HRP-goat anti-rabbit (1: 5,000, goat pAb, 111-035-003, Dianova, Germany) or HRP-goat anti-mouse (1:5,000 ...
-
No products found
because this supplier's products are not listed.
Steven A Kemp, et al.,
bioRxiv - Microbiology 2021
Quote:
... 9 DNA fragments with overlap sequences were amplified by PCR from a plasmid (phCMV1, Genlantis) encoding the full-length SARS-CoV-2 S gene (BetaCoV/Wuhan-Hu-1/2019 ...