-
No products found
because this supplier's products are not listed.
Raza Ali Naqvi, Araceli Valverde, Afsar Naqvi,
bioRxiv - Immunology 2023
Quote:
... Gene expression was examined using PCR array plate containing 88 primer sets directed against human NF-κB pathway genes and 8 housekeeping primer sets (Real Time Primers, LLC Elkins Park, PA). Briefly ...
-
No products found
because this supplier's products are not listed.
Luis Vigetti, et al.,
bioRxiv - Cell Biology 2024
Quote:
... biotinylated human serum albumin b-HSA (70 kg/mol, ACROBiosystems HSA-H82E3, Fisher Scientific), biotinylated heparan sulfate b-HS (synthesized using hydrazone ligation to 12 kg/mol HS and characterized by QCM-D to determine % of biotinylation as described in Thakar et al ...
-
No products found
because this supplier's products are not listed.
RA Seaborne, et al.,
bioRxiv - Physiology 2019
Quote:
... UBR5 PCR primers and pyrosequencing primers were purchased from EpigenDX (Hopkinton, MA, USA), rat assay no ...
-
No products found
because this supplier's products are not listed.
Dorota D. Klysz, et al.,
bioRxiv - Immunology 2023
Quote:
... and 2ul of each barcoded PCR primer (ApexBio, K1058). 14 PCR cycles were run for each sample ...
-
No products found
because this supplier's products are not listed.
Aidan E Gilchrist, et al.,
bioRxiv - Bioengineering 2019
Quote:
... and prepped for RT-PCR using PIPETMAX (Gilson, Middleton, WI). The CT of each gene/sample was performed in duplicate ...
-
No products found
because this supplier's products are not listed.
Joel D. Pearson, et al.,
bioRxiv - Microbiology 2020
Quote:
The 2019-nCoV TaqMan RT-PCR Kit from Norgen Biotek and 2019-nCoV ...
-
No products found
because this supplier's products are not listed.
Guofang Zhang, et al.,
bioRxiv - Immunology 2021
Quote:
... human serum albumin (HSA, from Solarbio Science & Technology Co., Ltd. China), fibrinogen (FG ...
-
No products found
because this supplier's products are not listed.
Andrea S. Baez-Gonzalez, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Quantitative RT-PCR (qPCR) was performed with FastSYBR mixture (CoWin Biosciences) on the AriaMx Real-Time PCR System (Agilent Technologies ...
-
No products found
because this supplier's products are not listed.
Thibaut Vignane, et al.,
bioRxiv - Biochemistry 2023
Quote:
... samples were incubated for 1.5 h at RT in the dark with 150 µM Cyanine5-Azide (Lumiprobe, #D3030), 300 µM Copper (II)-TBTA complex (Lumiprobe ...
-
No products found
because this supplier's products are not listed.
William N. Voss, et al.,
bioRxiv - Immunology 2024
Quote:
... resuspended in a one-step RT-PCR solution with an overlap extension VH and VL primer set as previously described,6 emulsified using a dispersion tube (IKA), and subjected to overlap-extension RT-PCR under the following conditions ...
-
No products found
because this supplier's products are not listed.
Ya-Lin Lu, et al.,
bioRxiv - Neuroscience 2020
Quote:
AGO HITS-CLIP was performed on cells after 2 weeks into reprogramming of miR-NS or miR-9/9*-124-expressing neonatal fibroblasts (ScienCell, 2310) at day 14 and day 21 ...
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
Cat# HY-19378,
inquire
Ask
Gege Yuan, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Set thalidomide (MedChemExpress, HY-14658) experimental groups (5 μM,10 μM ...
-
No products found
because this supplier's products are not listed.
Suman Khan, et al.,
bioRxiv - Microbiology 2023
Quote:
... 10.8% Drug Like Set (Enamine, Ukraine), 26.8% DiversetCL (Chembridge ...
-
No products found
because this supplier's products are not listed.
Elizaveta Lyapina, et al.,
bioRxiv - Biophysics 2022
Quote:
... 150 nM aprotinin (A.G. Scientific)] with the ratio of 50 μl per 100 ml of lysis buffer ...
-
No products found
because this supplier's products are not listed.
Mengjing Bao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-Khc (1:150, Cytoskeleton), rabbit anti-GFP (1:200 ...
-
No products found
because this supplier's products are not listed.
Jimin Yoon, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Cells were grown to confluency and then screened based on functional testing of the XBP1s construct using RT-PCR (described below) with or without 2 μg/mL doxycycline (dox; Alfa Aesar). The selected SupT1 single colony cell line encoding tetracycline-inducible XBP1s was then transduced with lentivirus encoding DHFR.ATF6(1–373 ...
-
No products found
because this supplier's products are not listed.
William N. Feist, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 150 μg/mL d-luciferin (Biosynth Chemistry & Biology ...
-
No products found
because this supplier's products are not listed.
Galen J. Correy, et al.,
bioRxiv - Biochemistry 2022
Quote:
... MicroRT tubing (Mitegen, RT-T1) with 5 μl of reservoir in the end was placed over the crystals to prevent dehydration ...
-
No products found
because this supplier's products are not listed.
Gurur Garip, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 150 μL of MTT Solvent (Biovision lot: 3K12K02992) was added to all wells and placed in the mixer for 15 min ...
-
No products found
because this supplier's products are not listed.
Kévin Leguay, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and Ki-67 (1:150, Biocare Medical #CRM325B). Bound primary antibodies were detected using peroxidase polymer (HRP-DAB ...
-
No products found
because this supplier's products are not listed.
Meg A. Younger, et al.,
bioRxiv - Neuroscience 2022
Quote:
... a 1 mL Dounce tissue grinder and pestle set (Wheaton 357538) that had been autoclaved at 121°C for 4 hr the previous day was pre-wetted with homogenization buffer ...
-
No products found
because this supplier's products are not listed.
Mikael Lundqvist, et al.,
bioRxiv - Neuroscience 2022
Quote:
... a new set of acute electrode pairs (tungsten, epoxy-coated, FHC) was lowered through a grid ...
-
No products found
because this supplier's products are not listed.
Alexander Neuhaus, et al.,
bioRxiv - Biophysics 2019
Quote:
... 150 rpm (New Brunswick Innova 42, Eppendorf, Hamburg, Germany). These cultures were used to inoculate 10 ml TM+ media (with appropriate antibiotics ...
-
No products found
because this supplier's products are not listed.
Jessica L Huang, et al.,
bioRxiv - Physiology 2022
Quote:
... 126 ng diphtheria toxin (List Biological Laboratories, Product # 150) in 200 μL 0.9% saline was injected into mice via IP injection on days 0 ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... set in a size 0 silicone cork (7752-15, Cole-Parmer, USA) in a 20 × 125 mm glass reactor tube (9826 ...
-
No products found
because this supplier's products are not listed.
Joseph L. Basalla, et al.,
bioRxiv - Biochemistry 2023
Quote:
Samples for imaging were set up in 16 well CultureWells (Grace BioLabs). Wells were passivated by overnight incubation in 5% (w/v ...
-
No products found
because this supplier's products are not listed.
Joseph L. Basalla, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Samples were set up in 96 well glass-bottom plates (Thomas Scientific) and absorbance at 350 nm was measured as previously described (15) ...
-
No products found
because this supplier's products are not listed.
Claire Bryant, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Male Wistar rats weighing ~150-200 g (Envigo, Indianapolis, IN) were purchased ...
-
No products found
because this supplier's products are not listed.
Huixin Yang, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... then 150 µM IP6 (Catalogue #: P0409; TCI America, Portland, OR) was added to initiate assembly ...
-
No products found
because this supplier's products are not listed.
Molly Brady, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a NIRF filter set (Semrock ICG-B, IDEX Health & Science LLC Rochester NY) and camera (Prosilica GT1380 ...
-
No products found
because this supplier's products are not listed.
Lianghui Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... plus 1:150 anti-MYC-FITC (chicken polyclonal, Immunology Consultants Laboratory) for detection of bound sACE22-IgG1 or mAbs ...
-
No products found
because this supplier's products are not listed.
Christian A. E. Westrip, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Gels were run at 150 volts in1x Tris/Glycine/SDS (National diagnostics) running buffer ...
-
No products found
because this supplier's products are not listed.
Wen Shao, et al.,
bioRxiv - Biochemistry 2021
Quote:
... supplemented with complete sets of fresh proteinase inhibitors) and lysed using a bead beater (Biospec). Homogenized cell suspension was then treated with 75 μL of 10 mg/mL heparin (Sigma ...
-
No products found
because this supplier's products are not listed.
Logan K. Smith, Kareem Fawaz, Bebhinn Treanor,
bioRxiv - Immunology 2020
Quote:
... Fluorescence intensity was converted into molecular count using a fluorescence standard38 (Quantitation set, Bangs Laboratories).
-
No products found
because this supplier's products are not listed.
Rogers KJ., et al.,
bioRxiv - Microbiology 2019
Quote:
Footpad infections were performed by restraining mice (TV-150 STD Braintree Scientific Inc.) and injecting 1000 PFU in 25µl of virus or PBS in the footpad of the right hindpaw ...
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Dorotea Fracchiolla, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 150 mM NaCl and 1 mM DTT (Figure 3D) or GFP-Trap beads (Chromotek) when E3-GFP was used (Figure 2A) ...
-
No products found
because this supplier's products are not listed.
Gen Honda, et al.,
bioRxiv - Biophysics 2020
Quote:
... Prepared SU-8 and glass substrates were set at the bottom of φ35 mm culture dish (MatTek) using a 9 × 9 mm2 frame seal (SLF0201 ...
-
No products found
because this supplier's products are not listed.
Brian R. Isett, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Virus (Striatum: 0.5-1 μl, GPe: 150 nL) was injected with a Nanoject (Drummond Scientific) through a pulled glass pipet (tip diameter ∼30 μm ...
-
No products found
because this supplier's products are not listed.
Dapeng Chen, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The 10 µm pore-size filter discs and the column sets were acquired commercially (Boca Scientific, Dedham, MA). Escherichia coli bacteriophage MS2 was purchased from ATCC (Manassas ...
-
No products found
because this supplier's products are not listed.
Marina E. Garrett, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Vital signs were monitored with a Physiosuite (model # PS-MSTAT-RT; Kent Scientific). Eye drops (Lacri-Lube Lubricant Eye Ointment ...
-
No products found
because this supplier's products are not listed.
Alyssa K. Hahn, et al.,
bioRxiv - Immunology 2020
Quote:
... The chromatographic run used a Cogent Diamond Hydride HILIC 150 × 2.1 mm column (MicroSolv, Eatontown, NJ) in normal phase with our established elution methods[26] ...
-
No products found
because this supplier's products are not listed.
Daniel Nichol, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... Sequencing of the SHV gene was performed using M13 primers (MCLab, Harbor Way, CA).
-
No products found
because this supplier's products are not listed.
Nicholas J Saner, et al.,
bioRxiv - Physiology 2020
Quote:
... on Day 1 each participant ingested 150 mL of Deuterium Oxide (D2O) (70 atom %, Cambridge Isotope Laboratories) as previously described (63) ...
-
No products found
because this supplier's products are not listed.
Elizaveta O. Boldinova, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Primer-18 was 5′-labeled with [γ-32P]-ATP by T4 polynucleotide kinase (SibEnzyme, Russia) and annealed to the corresponding unlabeled Template-55 at a molar ratio of 1:1.1 ...
-
No products found
because this supplier's products are not listed.
Ji Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Primary antibody was removed and plates were washed twice with 150 μL/well of 1x DPBS+Tween20 (TEKnova Cat # P0297 ...
-
No products found
because this supplier's products are not listed.
Yameng Huang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 150 mM NaCl) and then incubated with GFP-nAb Magnetic Agarose beads also known as GFP-Trap (Allele Biotech or Chromotek), EZview Red Anti-HA Affinity Gel (Millipore ...
-
No products found
because this supplier's products are not listed.
Sara Meril, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 10μM forward and reverse primers (see Table 1) and 5μL of AzuraView GreenFast qPCR Blue Mix LR (Azura Genomics, AZ2305). Data was analyzed using QuantStudio 5 software (Thermo-Scientific) ...
-
No products found
because this supplier's products are not listed.
Steven A Kemp, et al.,
bioRxiv - Microbiology 2021
Quote:
... 9 DNA fragments with overlap sequences were amplified by PCR from a plasmid (phCMV1, Genlantis) encoding the full-length SARS-CoV-2 S gene (BetaCoV/Wuhan-Hu-1/2019 ...