-
No products found
because this supplier's products are not listed.
Denisa Bojkova, et al.,
bioRxiv - Microbiology 2022
Quote:
... H1N1 (Influenza A Virus) Nucleoprotein (Bioss, #bs-4976R, 1:4000), ISG15 (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Danyal Akarca, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and critically point dried (CPD; Quorum Technologies, West Sussex, UK), using CO2 as the substitution fluid ...
-
No products found
because this supplier's products are not listed.
Angela Ma, et al.,
bioRxiv - Microbiology 2022
Quote:
... adenovirus (D3Ultra Respiratory Virus Screening & Identification kit, Quidel, San Diego, CA), and cytomegalovirus (D3 DFA Cytomegalovirus Immediate Early Antigen Identification kit ...
-
No products found
because this supplier's products are not listed.
Matthew D. Lauver, et al.,
bioRxiv - Immunology 2022
Quote:
... Virus dilutions were combined 1:1 with 0.45% sheep erythrocytes (Innovative Research) and incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Jieqiong Qu, et al.,
bioRxiv - Microbiology 2023
Quote:
... CHIKV virus stock (5 × 108 TCID50/mL) and full human blood (Sanquin) was 1:2 mixed to make the infectious blood meal with a final virus titer of 1.7× 108 TCID50/ml ...
-
No products found
because this supplier's products are not listed.
Rueyhung R. Weng, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5% human platelet lysate (PLS1, Compass Biomedical), 70 ng/mL IL-15 (AF-200-15 ...
-
No products found
because this supplier's products are not listed.
Youssouf Sereme, et al.,
bioRxiv - Microbiology 2020
Quote:
... A poliovirus serology-positive control serum (Poliomyelitis virus kit, GenWay, San Diego, California, USA) was also used as a control ...
-
No products found
because this supplier's products are not listed.
Daniela Niemeyer, et al.,
bioRxiv - Microbiology 2021
Quote:
... and B.1.351 was assessed by a surrogate virus neutralization test (cPass Assay, Medac, Wedel, Germany) as described previously (Momsen Reincke et al. ...
-
No products found
because this supplier's products are not listed.
Chenyan Ma, et al.,
bioRxiv - Neuroscience 2023
Quote:
... starting at day 3 post virus injection (250 mg tamoxifen per kg of chow, Research Diets). Mice were gavaged with two additional doses of tamoxifen (250 mg/kg body weight ...
-
No products found
because this supplier's products are not listed.
Susanne A. Wycislo, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Equivalent amounts of “light”-labeled control and “heavy”-labeled GFP–containing lysates or “light”-labeled control and “heavy”-labeled GFP–containing lysates were incubated (separately) with GFP-Trap agarose beads (Allele Biotechnology, San Diego, CA) for 30 min at 4°C ...
-
No products found
because this supplier's products are not listed.
Eugenia Zah, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The lysate supernatant was ultracentrifuged with iodixanol (OptiPrep; StemCell Technologies) density gradient solutions (54% ...
-
No products found
because this supplier's products are not listed.
Meredith J. Sigman, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Clarified lysates were combined with 2 μL of AGO4 antibody (Agrisera) or 2uL of rabbit IgG as a mock IP (Cell Signaling Technology) ...
-
No products found
because this supplier's products are not listed.
Jie Dong, et al.,
bioRxiv - Plant Biology 2020
Quote:
... The lysate was filtered through a 30 μm mesh (Sysmex Partec). Propidium iodide (Sigma ...
-
No products found
because this supplier's products are not listed.
Anna Fortuny, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Lysates were homogenised with a tight Dounce homogeniser (DWK Life Sciences) and nuclei were collected by centrifugation ...
-
No products found
because this supplier's products are not listed.
Han Sun, et al.,
bioRxiv - Microbiology 2023
Quote:
... Lysates were then injected with 40 µl firefly luciferin substrate (Biosynth) and luminescence was measured using a SpectraMax L plate reader (Molecular Devices).
-
No products found
Elisa A. Waxman,
bioRxiv - Neuroscience 2019
Quote:
... and immunoreactivity was detected using chemiluminscent reagent (West Pico, ThermoFisher-Pierce or WesternBright ECL, Advansta, Menlo Park, CA) and image capture with an ImageQuant LAS4000 system and software (GE).
-
No products found
because this supplier's products are not listed.
Milène Vandal, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The lysate was incubated with 100 U/mL salt-active nuclease (Arcticzymes) at 37°C for 1 h and then centrifuged at 2000 xg for 15 min ...
-
No products found
because this supplier's products are not listed.
Michael D. Vahey, Daniel A. Fletcher,
bioRxiv - Microbiology 2019
Quote:
... replacing media with virus growth media supplemented with or without a specified concentration of oseltamivir carboxylate (Toronto Research Chemicals O700980), but without TPCK-treated trypsin ...
-
No products found
because this supplier's products are not listed.
Mallika Ghosh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 20 µg of cell lysate were added to PROTAC assay plate (LifeSensors; PA950) and incubated for at RT for 2h ...
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A further lysate (600 μl) was incubated with 5 μg rabbit immunoglobulins (Vector Laboratories) to control for nonspecific interactions ...
-
No products found
because this supplier's products are not listed.
Jun Zhang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Whole-cell lysates (200 μg protein/sample) were incubated with UbiQapture-Q Matrix (Biomol) by gentle agitation at 4°C overnight to pull down all ubiquitinated proteins according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Nitin Raj, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... the pre-cleared lysates were incubated with 1-2 µg Mettl3 polyclonal antibody (Abclonal, A8370) or 1-2 µg Mettl14 polyclonal antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Matilda Shackley, et al.,
bioRxiv - Cell Biology 2020
Quote:
... IP1 concentrations were measured from cell lysates using the HTRF IP-One immunoassay kit (CisBio). Fluorescence was measured and IP1 levels were quantified using the same methodology as the cAMP assay.
-
No products found
because this supplier's products are not listed.
Federica Cappuccini, et al.,
bioRxiv - Immunology 2021
Quote:
Mouse MHC samples and all tryptic digested lysates were analysed on a TripleTOF 5600 (SCIEX) coupled to an Eksigent ekspert nanoLC 400 cHiPLC system ...
-
No products found
because this supplier's products are not listed.
Saliha Musovic, et al.,
bioRxiv - Physiology 2021
Quote:
... P2Y2R protein levels were determined in cell lysate with specific mouse ELISA (catalog # MBS7200782, MyBioSource).
-
No products found
because this supplier's products are not listed.
Flavia Ferrantelli, et al.,
bioRxiv - Microbiology 2022
Quote:
... virus dilutions and number of deaths/group after challenge were used to calculate the LD50 (Quest Graph™ LD50 Calculator, AAT Bioquest, Inc.). The Kaplan-Meier curve was used to show survival rate differences among groups of animals challenged with different doses of SARS-CoV-2 virus ...
-
No products found
because this supplier's products are not listed.
Wenhui Qiao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Aβ oligomers in TBS and TBSX lysates were detected by commercial kits (Biosensis, BEK-2215-2P). sAPPa ...
-
No products found
because this supplier's products are not listed.
Ella V. Rodwell, et al.,
bioRxiv - Microbiology 2021
Quote:
... The lysate was treated with 10 µL 20 mg/mL Proteinase K (BIOLINE, Cat#BIO-37037) and purified using the Norgen Phage DNA Isolation Kit (cat ...
-
No products found
because this supplier's products are not listed.
Kuan-Yi Lu, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 mg parasite protein lysate was precleaned with 600 μL uncoated agarose beads (Echelon Biosciences, Salt Lake City, UT) at 4 °C for 90 min ...
-
No products found
because this supplier's products are not listed.
Kristin S. Fitzpatrick, et al.,
bioRxiv - Immunology 2022
Quote:
... and Vaccinia virus B8R (TSYKFESV, Biomatik).
-
No products found
because this supplier's products are not listed.
Subeena Sood, et al.,
bioRxiv - Immunology 2023
Quote:
... A fixed concentration of SARS-CoV-2 GFP pseudotyped virus (BPS Biosciences) was added and the plate incubated for 60 minutes at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Mahnoush Bahjat, et al.,
bioRxiv - Immunology 2020
Quote:
... slides were treated with Super Block (AAA125, ScyTek Laboratories, West Logan, UT) for 15 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Taeyong Kwon, et al.,
bioRxiv - Microbiology 2022
Quote:
... The same amount of the virus was mixed with 45 µL of human saliva (Lee Biosolutions) or medium and transferred into a 2 mL tube or onto stainless steel in the 12-well plate ...
-
No products found
because this supplier's products are not listed.
Lisa-Marie Kuhl, et al.,
bioRxiv - Genetics 2020
Quote:
... Cell lysates were mixed on a VXR basic Vibrax (IKA) for 2 min at 1500 rpm ...
-
No products found
because this supplier's products are not listed.
Victoria L. Messerschmidt, et al.,
bioRxiv - Bioengineering 2021
Quote:
Poly(D, L-lactide-co-glycolic acid) nanoparticles (PLGA, 50:50, Akina Inc., West Lafayette, IN, USA) of two different molecular weights including 55–65 kDa (HMW Nanoparticles ...
-
No products found
because this supplier's products are not listed.
Filippo Bianchini, et al.,
bioRxiv - Immunology 2022
Quote:
... Avi-tagged SARS-CoV-2 RBD and SD1-RBD (both corresponding to SARS-CoV-2 ancestral virus) were biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Ovalbumin (Sigma ...
-
No products found
because this supplier's products are not listed.
James Brett Case, et al.,
bioRxiv - Microbiology 2020
Quote:
... Virus was plaque-purified on Vero CCL81 cells in the presence of 25 μg/ml of cytosine arabinoside (TriLink BioTechnologies), and plaques in agarose plugs were amplified on Vero CCL81 cells ...
-
No products found
because this supplier's products are not listed.
Avital Licht-Murava, et al.,
bioRxiv - Neuroscience 2022
Quote:
... per ml culture medium at DIV 8 using Lipofectamine 3000 5 h before infection with vesicular stomatitis virus (VSV) at 100 MOI or with adenovirus-eGFP (Ad5CMV-eGFP, lot #ad3586, Viral Vector Core Facility, Carver College of Medicine ...
-
No products found
because this supplier's products are not listed.
Sara Al Rawi, et al.,
bioRxiv - Neuroscience 2021
Quote:
Fbxo7 was immunoprecipitated from cell lysates using 2μl of anti-Fbxo7 antibody (Aviva), or isotype matched control ...
-
No products found
because this supplier's products are not listed.
Jay Leipheimer, et al.,
bioRxiv - Microbiology 2019
Quote:
Whole-cell lysate from yeast cultures was obtained by glass bead((#9831 RPI) mediated mechanical disruption using Bullet Blender Gold (Next Advance Model:BB2U-AU ...
-
No products found
because this supplier's products are not listed.
Vigneshwaran Venkatesan, et al.,
bioRxiv - Biochemistry 2022
Quote:
... the protein lysate was analysed for haemoglobin tetramer using G8 HPLC Analyzer (Tosoh). The globin chain analysis was performed using HPLC equipment with UV detector (Shimadzu ...
-
Cat# ZK312-1,
USD $795.0/mg
Ask
Milica Moskovljevic, et al.,
bioRxiv - Immunology 2024
Quote:
... Cells stimulated with either lysates of CMV-infected fibroblasts (Virusys, 10 μg/mL), overlapping Gag 15mer peptides (HIV-1 Gag peptide pool ...
-
No products found
because this supplier's products are not listed.
Julie M. Button, Suchetana Mukhopadhyay,
bioRxiv - Microbiology 2021
Quote:
Five microliters of purified virus or pelleted cores were placed on a Formvar and carboncoated 300 mesh grid (Ted Pella Inc., Redding, CA) and stained with 1% uranyl acetate ...
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
No products found
because this supplier's products are not listed.
Gordon Rix, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... Lysate was clarified by spinning 14,000g for 20 min at 4 °C (New Brunswick Avanti J-30I). Protein was purified over hand-packed HisPur™ Ni-NTA Resin (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Nicholas McCaul, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... IgM was immunoprecipitated from lysates or media samples with a goat anti-mouse IgM antibody (Southern Biotech). Immunoprecipitates were washed with lysis buffer and eluted from beads with reducing SDS-PAGE sample buffer and analyzed by SDS-PAGE ...
-
No products found
because this supplier's products are not listed.
Kelly T. Rios, et al.,
bioRxiv - Microbiology 2024
Quote:
The gametocyte and zygote lysates were mechanically lysed with a 1 mL Dounce homogenizer (Wheaton, Cat# 357538) for one minute on ice with a tight pestle following chemical lysis ...
-
No products found
because this supplier's products are not listed.
Matthew L. Turner, et al.,
bioRxiv - Microbiology 2019
Quote:
... Potassium was measured in the cleared lysates using a Jenway PFP7 flame photometer (Cole-Parmer, Stone, Staffordshire, UK).
-
No products found
because this supplier's products are not listed.
Michael J. D. Daniels, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 25 μL lysate was combined with 175 μL cathepsin probe L (Z-Phe-Arg-AMC, 45 μM, Bachem) or C (H-Gly-Phe-AMC ...
-
No products found
because this supplier's products are not listed.
Sana Charaoui-Boukerzaza, et al.,
bioRxiv - Microbiology 2019
Quote:
... The count of viable bacteria was carried out by plating serial dilutions of the lysates on blood agar (43041, bioMérieux) using an automatic seeder (EasySpiral Dilute, Interscience). The calculation of the bacterial loads was performed after incubation at 37°C for 24 h ...