-
No products found
because this supplier's products are not listed.
Weihan Gu, et al.,
bioRxiv - Pathology 2023
Quote:
... and then subcultured in 15-ml minimal medium with a 100-fold dilution in a 50-ml culture tube (Crystalgen, USA). When the bacterial culture was grown to an OD600 of target value (0.5 ...
-
No products found
because this supplier's products are not listed.
Asvin KK Lakkaraju, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 1.5 ug plasmid DNA was mixed with 500 ng linearized BAC10:KO1629 DNA (Oxford Expression Technologies Ltd.) and 8 ul Cellfectin™ II reagent (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Carolin Reitter, et al.,
bioRxiv - Microbiology 2021
Quote:
... coli were quantified in 100 ml water sample using the most probable number (MPN) method Colilert®-18/Quanti-Tray® (IDEXX Laboratories, Westbrook, USA) according to ISO 9308-2 (2012) ...
-
No products found
because this supplier's products are not listed.
Yuhan Jiang, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 75 µL of the cell lysate was mixed with 100 µL of 70% nitric acid (Fisher chemical, Cat# A509P212) in 15 mL metal-free tube (Labcon, Cat# 3134-345-001-9). The samples were heated in 60°C water bath for 1 h to make sure the sample is fully digested ...
-
No products found
because this supplier's products are not listed.
Rida Rehman, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Rabbit anti-HELLS (1:100, Antibodies.com), Rat anti-Vitronectin (1:100 ...
-
No products found
because this supplier's products are not listed.
Tabitha E. Hoornweg, et al.,
bioRxiv - Microbiology 2020
Quote:
... 100 µl/well TMB Substrate (Surmodics) was added ...
-
No products found
because this supplier's products are not listed.
Peng V. Wu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... CK19 (rabbit, 1:100, Abbomax 602-670), Ki-67 (rat ...
-
No products found
because this supplier's products are not listed.
Niraj Mishra, et al.,
bioRxiv - Microbiology 2019
Quote:
... they were resuspended in FACS-B and filtered through 100 μm nylon meshes (Sefar, ELKO Filtering, 03-100/44) prior to analysis on a flow cytometer (LSR Fortessa X-20 ...
-
No products found
because this supplier's products are not listed.
Héloïse Grunchec, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Two hundred vasa-Cas9 embryos were injected with a mixture containing 100 ng/μL pU6-chiRNA:sgRNA and 100 ng/μL ssODN (BestGene Inc.). Transformant G0 flies (48 females and 44 males ...
-
No products found
because this supplier's products are not listed.
Igor P. Oscorbin, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 100 U of T7 RNA polymerase (SibEnzyme, Russia), 1× reaction buffer (50 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Liang Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Sheep anti- Chx10 (Exalpha Biologicals, X1179P, 1:100), Gunine Pig anti-RBPMS (PhosphoSolutions ...
-
No products found
because this supplier's products are not listed.
Wenjing Liu, et al.,
bioRxiv - Pathology 2020
Quote:
... the tissues were incubated with primary antibodies against Wilms tumour-1 (WT1) (1:100, Servicebio, GB11382) and synaptopodin (1:100, ZEN BIO, 508484). The slides were then incubated with HRP-labelled donkey anti-rabbit secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Megan S. Reich, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The separation of Sr was processed in a 100 µL microcolumn loaded with Sr-spec Resin (100 - 150 µm; Eichrom Technologies, LLC). The matrix was rinsed out using 6 M HNO3 ...
-
No products found
because this supplier's products are not listed.
Clayton M. Carey, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... 150 mg 2-chlorotrityl resin (ChemPep, 100-200 mesh) was washed with DMF and DCM and swelled for 30 min ...
-
No products found
because this supplier's products are not listed.
Xiuping Sun, Bing Chen, Zhiwei Song, Lei Lu,
bioRxiv - Cell Biology 2021
Quote:
... Bafilomycin A1 (working concentration: 100 nM) was from Chemscene.
-
No products found
because this supplier's products are not listed.
Mohammed N.A. Siddiquey, et al.,
bioRxiv - Microbiology 2020
Quote:
... 10 μg/mL ciprofloxacin (Genhunter), and either 5% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Daniel Z. Radecki, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Lentivirus pellet was then resuspended in 100□l LentiGuard reagent (Cellomics) and stored at -80⁰C until use ...
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Thomas A. Desautels, et al.,
bioRxiv - Microbiology 2023
Quote:
... diluted to 50-100 nM in RexxipF buffer (Gyros Protein Technologies). Resulting values were fit to a 4PL model or calculated as area under the curve (AUC ...
-
No products found
because this supplier's products are not listed.
Tianzi Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 10 μg/mL ECGS (Cell Biologics), 50 ug/mL heparin (Sigma) ...
-
No products found
because this supplier's products are not listed.
Clara Lambert, et al.,
bioRxiv - Microbiology 2023
Quote:
... essentially composed of C18:1Δ9 or 100 μM C17:1 (Larodan, Sweden). Overnight cultures were diluted to an OD600nm = 0.05 and grown in the indicated medium to the exponential phase (OD600nm comprised between 0.4 and 0.5).
-
No products found
because this supplier's products are not listed.
Ravi K. Patel, et al.,
bioRxiv - Immunology 2023
Quote:
... crude collagenase (0.2 mg/ml; Crescent Chemical), and DNase I (0.02 mg/ml ...
-
No products found
because this supplier's products are not listed.
Richard J. Burt, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-dsRNA antibody J2 (1ug/ml) (SCICONS)was added at 1:100 dilution in 1% BSA followed by DyLight® 488 Anti-Mouse IgG (H+L ...
-
No products found
because this supplier's products are not listed.
Weizhen Li, Emilia Entcheva,
bioRxiv - Bioengineering 2019
Quote:
Human iPSC-derived cardiomyocytes (iCell Cardiomyocytes2 CMC-100-012-001) from Cellular Dynamics International (CDI) ...
-
No products found
because this supplier's products are not listed.
Xin-Zi Tang, et al.,
bioRxiv - Immunology 2022
Quote:
... mice were first sensitized by intraperitoneal (i.p.) injections with 100 μg Endograde OVA (Hyglos) mixed with 100 μl alum (Alhydrogel ...
-
No products found
because this supplier's products are not listed.
Carolin Ulbricht, et al.,
bioRxiv - Immunology 2020
Quote:
... or CpG (10 μg/ml, TIB Molbiol Berlin). Cell culture imaging experiments with ionomycin stimulation were performed using an open perfusion chamber system ...
-
No products found
because this supplier's products are not listed.
Sade W. Clayton, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and confirming the accuracy of each puncture with X-ray images (Faxitron UltraFocus 100, Hologic). Mice were anesthetized with vaporized 3% isoflurane/oxygen during the procedure and given a onetime subcutaneous injection of 1mg/mL carprofen at 5mg/kg/mouse as analgesia immediately after needle punctures ...
-
No products found
because this supplier's products are not listed.
Atomu Yamaguchi, et al.,
bioRxiv - Immunology 2023
Quote:
... the pellet was processed with 100 μL of PROPREP reagent (iNtRON Biotechnology Co., Ltd. Japan), followed by incubation on ice for 20 min ...
-
No products found
because this supplier's products are not listed.
Nathan M. Belliveau, et al.,
bioRxiv - Cell Biology 2022
Quote:
... resuspended in 10 mL PolymorphPrep (Cosmo Bio USA #AXS1114683) and added to the bottom of a 50 mL conical tube ...
-
No products found
because this supplier's products are not listed.
Michelle El-Khoury, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Rabbit anti-GFP (TP401) (Immunofluorescence: 1:100) was obtained from Torrey Pines Biolabs (Secaucus, NJ, USA).
-
No products found
because this supplier's products are not listed.
Mayank Verma, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 1 µg/ml anti-FLT1 monoclonal antibody (Angio-Proteomie, MAB7072), inhibitors of FLK1 ...
-
No products found
because this supplier's products are not listed.
Julien Bous, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 2 mM EDTA and 200 μg/mL Flag peptide (Covalab).
-
No products found
because this supplier's products are not listed.
Oscar R. Benavides, et al.,
bioRxiv - Biophysics 2023
Quote:
... in a 10 mL rotating wall vessel (RWV) bioreactor (Synthecon) and fixed with neutral buffered formalin ...
-
No products found
because this supplier's products are not listed.
Kunimichi Suzuki, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cryo-sectioned coronally at 100 µm thickness and directly mounted on gelatin-coated slides (FD NeuroTechnologies, #PO101) with the help of solution C provided in the kit ...
-
No products found
because this supplier's products are not listed.
Joseph H. Chapman, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The plate was sealed with Avant ThermalSeal optically clear polyester RT-PCR film (MIDSCI TS-RT2-100), briefly spun down ...
-
No products found
because this supplier's products are not listed.
Christian P. Rivera, et al.,
bioRxiv - Pathology 2019
Quote:
... 5 mL of Microfil HV 122 Yellow (Flow Tech, Carver, MA) was manually perfused ...
-
No products found
because this supplier's products are not listed.
Gamaliel Junren Ma, et al.,
bioRxiv - Biophysics 2019
Quote:
... UK) and 100-nm diameter silica nanoparticles (catalog no. SISN100) were obtained from nanoComposix (San Diego, CA, USA).
-
No products found
because this supplier's products are not listed.
KM Hudock, et al.,
bioRxiv - Immunology 2022
Quote:
... 100mU/ml human NE protein (Athens Research & Technology #16-14-051200, ART), 100μU/ml human PR3 protein (ART #16-14-161820 ...
-
No products found
Sylvia A Newbold, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Blots were finally developed with 1 ml of WesternBright ECL substrate (Advansta) and imaged with a ChemiDoc XRS+ (BioRad) ...
-
No products found
because this supplier's products are not listed.
Ingrid Jin Schanke, et al.,
bioRxiv - Biophysics 2021
Quote:
... Thin films were deposited onto glass cover slips (Menzel Gläss #1, 100-150 μm thickness; WillCo Wells B.V., Amsterdam, NL). SiO2 films were deposited by E-beam physical vapor deposition using an EvoVac instrument (Ångstrom Engineering ...
-
No products found
because this supplier's products are not listed.
Kelsey A. Haugh, et al.,
bioRxiv - Microbiology 2020
Quote:
... or permeabilized with PBS containing 0.2% Triton X-100 (for stains of intracellular proteins) and treated with Fc receptor blocker (Innovex Biosciences), Richmond ...
-
No products found
because this supplier's products are not listed.
Stephanie H Chen, et al.,
bioRxiv - Genomics 2021
Quote:
... A pilot run on an Illumina iSeq 100 with 2 x 150 bp paired end sequencing run was performed for QC using hic_qc v1.0 (Phase Genomics, 2019) with i1 300 cycle chemistry ...
-
No products found
because this supplier's products are not listed.
Kiall F. Suazo, et al.,
bioRxiv - Biochemistry 2024
Quote:
... was then used to quantify protein yields and aliquots of 100 μg were subjected to click reaction with TAMRA-N3 (25 μM TAMRA-N3 (BroadPharm), 1 mM TCEP ...
-
No products found
because this supplier's products are not listed.
Longhuan Ma, et al.,
bioRxiv - Immunology 2024
Quote:
... then individual colonies were grown in 5 ml of BHI media (Anaerobe Systems) under anaerobic conditions for 16 h ...
-
No products found
because this supplier's products are not listed.
Rafael Alcalá-Vida, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Purified nuclei were resuspended in 100 µl and filtered using cells strainers of 50 µm pore size (Sysmex Partec, Kobe, Japan) and posteriorly sorted and imaged using a 60x objective at a maximum speed of 600 nuclei/s depending on the sample concentration ...
-
No products found
because this supplier's products are not listed.
Pierre Bensidoun, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 100-μl cell suspension was added to a 96-well glass-bottom plate (MGB096-1-2-LG-L; Brooks Life Science Systems) previously coated with concanavalin A (Con A ...
-
No products found
because this supplier's products are not listed.
Evgeniia N. Bykonia, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were washed 3 times and incubated with 100 μL HRP-conjugated anti-mouse IgG secondary antibody (L20/01; HyTest; 1:25000) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Julian Schmitz, et al.,
bioRxiv - Bioengineering 2021
Quote:
Shake flask cultivation was performed as triplicates in 125 mL shake flasks (Flat Base, TriForest, USA) with a cultivation volume of 60 mL ...
-
No products found
because this supplier's products are not listed.
MaKenzie R. Scarpitti, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... G4s were selectively stained with 0.1 mg/mL N-methyl mesoporphyrin IX (NMM) (Frontier Scientific # NMM58025MG) in milliQ water for 10 min in the dark ...
-
No products found
because this supplier's products are not listed.
Ralf Schmidt, et al.,
bioRxiv - Immunology 2021
Quote:
... bulk T cells were frozen in Bambanker Cell Freezing Medium at 50e6 cells/ml (Bulldog Bio cat BB01) and stored at −80°C for short term or liquid nitrogen for long term storage ...