-
No products found
because this supplier's products are not listed.
Diego S. Val, et al.,
bioRxiv - Biochemistry 2023
Quote:
The substrate 4-Nitrophenyl phosphorylcholine (NPPC, Toronto Research Chemicals) was used to measure the activity of enzymes in aqueous solution.
-
No products found
because this supplier's products are not listed.
Sonja Schmid, Thorsten Hugel,
bioRxiv - Biophysics 2019
Quote:
... This favors biotinylated heterodimers to bind to the polyethylene glycol (PEG, Rapp Polymere, Tuebingen, Germany) passivated and neutravidin (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Greg T. Chism, Wiley Faron, Anna Dornhaus,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... and then weighed each substrate using a digital scale (Ohaus, USA) to the nearest 0.00001g.
-
No products found
because this supplier's products are not listed.
Sefora Conti, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... cells were mechanically dissociated from gel substrates using cell scrapers (Biologix) and lysed with RIPA (Radio-Immunoprecipitation Assay ...
-
No products found
because this supplier's products are not listed.
Vadim Fedyuk, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Biotinylated antibodies were incubated on surface in IMB2 [10 mM MES pH 6.5 (Boston Bioproducts Inc, NC9904354), 60 mM KCL ...
-
No products found
because this supplier's products are not listed.
Jonas M. Holzinger, et al.,
bioRxiv - Microbiology 2023
Quote:
... BPI was detected with biotinylated anti-BPI antibody 4H5 (Cat# HM2042, RRID: AB_532909; Hycult Biotech, Uden, Netherlands) and Streptavidin-PE (Agilent ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... 500 nM substrate RNA (5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3, Bio-Synthesis, Inc.), and 60 nM yDcpS at 37 °C for 60 minutes ...
-
No products found
because this supplier's products are not listed.
Shuang-yong Xu, et al.,
bioRxiv - Microbiology 2021
Quote:
... Substrate and cleavage product peaks were analyzed by PeakScan software (ABI/ThermoFisher).
-
No products found
because this supplier's products are not listed.
Michihito Sasaki, et al.,
bioRxiv - Microbiology 2021
Quote:
... and visualized with a Histofine diaminobenzidine substrate kit (Nichirei Biosciences, Tokyo, Japan).
-
No products found
because this supplier's products are not listed.
Soohyun Kim, et al.,
bioRxiv - Microbiology 2022
Quote:
... The peptide was biotinylated on the N terminus via coupling with biotin-polyethylene glycol (PEG)4-propionic acid (ChemPep). Dry peptide resin was cleaved using 94% trifluoroacetic acid ...
-
No products found
because this supplier's products are not listed.
David Veysset, et al.,
bioRxiv - Bioengineering 2021
Quote:
... on top of a 1-inch borosilicate glass substrate (n°2 coverslip, ChemGlass) (Layer 5) ...
-
No products found
because this supplier's products are not listed.
Parinya Samakkarnthai, et al.,
bioRxiv - Physiology 2023
Quote:
... Then 10 μM or 20 μM of fluorogenic substrate C12FDG (Setareh Biotech, USA) were added to IMR90 cells or MEFs ...
-
No products found
because this supplier's products are not listed.
John C. Newman, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Primary antibodies used were biotinylated 82E1 (1:1000; Immuno-Biological Laboratories) for Aβ plaques detection and rabbit anti-NPY (1:2000; Immunostar). NPY Primary antibodies were detected with biotinylated donkey anti-rabbit (1:500 ...
-
No products found
because this supplier's products are not listed.
Yongchan Lee, et al.,
bioRxiv - Biochemistry 2021
Quote:
... transport of 100 μM radioisotope substrates (L-[14C]ornithine (2 Ci/mol; Moravek Biochemicals), L-[3H]tyrosine (10 Ci/mol ...
-
No products found
because this supplier's products are not listed.
Liwei Yang, Jesse Liu, Revanth Reddy, Jun Wang,
bioRxiv - Bioengineering 2022
Quote:
... 30 μL of 200 μM amine-ended biotinylated oligos was incubated with 100 mM photocleavable DBCO-NHS ester (Click Chemistry Tools) at 1 ...
-
No products found
because this supplier's products are not listed.
Joachim Denner, et al.,
bioRxiv - Microbiology 2020
Quote:
... The coupled beads were then incubated with samples and bound PAI-1/tPA complexes detected using biotinylated rabbit anti-tPA antibody (Molecular Innovations) and streptavidin-PE (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Alam García-Heredia, et al.,
bioRxiv - Microbiology 2020
Quote:
... lipid-linked peptidoglycan precursors were biotinylated by subjecting organic extracts to an in vitro PBP4-mediated exchange reaction with biotin-D-lysine (Chem-Impex International ...
-
No products found
because this supplier's products are not listed.
Matthew D. Slein, et al.,
bioRxiv - Immunology 2023
Quote:
... The cells were then washed with PBS + 1% BSA prior to staining with 100 µL of 1 µg/mL biotinylated goat anti-guinea pig C3 antibody (ICL labs) at room temperature for 1 hour ...
-
No products found
because this supplier's products are not listed.
Anil Verma, et al.,
bioRxiv - Immunology 2023
Quote:
... were labeled with biotinylated anti-His tag monoclonal antibody (ThermoScientific) and used to capture His-tagged clade C gp120 Du151 protein (Immune Technologies). The gp120-expressing beads were then incubated with triplicate 5-fold dilutions of heat-inactivated serum samples in V-bottom plates for 1h at 37°C ...
-
No products found
because this supplier's products are not listed.
J. De Smet, et al.,
bioRxiv - Microbiology 2021
Quote:
... both larval and substrate samples were also homogenized using a stomacher (BagMixer 400CC, Interscience, France) for 1 minute.
-
No products found
because this supplier's products are not listed.
Yasuko Tobari, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... the sections were stained with 0.02% 3,3-diaminobenzidine substrate solution (Dojindo Molecular Technologies, Kumamoto, Japan) for 5 min ...
-
No products found
because this supplier's products are not listed.
Zahra Allahyari, et al.,
bioRxiv - Bioengineering 2019
Quote:
The PLL-g-PEG patterned substrates were examined using an MFP-3D AFM (Oxford Instruments). TR800PSA cantilevers (Oxford Instruments ...
-
No products found
because this supplier's products are not listed.
Jian Cui, et al.,
bioRxiv - Immunology 2023
Quote:
... 12.5 μL of the FXa substrate RGR-XaChrom (4 mM, Enzyme Research Laboratories#100-03) was added and the mixture was incubated at 37 °C for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Paulus Mrass, et al.,
bioRxiv - Immunology 2022
Quote:
... we incubated the lungs for 30 minutes with a biotinylated anti-H3N2 influenza viral particle antibody in T cell culture medium (ViroStat, Cat#: 1317), followed by washing and staining with Streptavidin Alexa Fluor 555 (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Tal M. Dankovich, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Labeling was performed with 1:500 biotinylated WFA or HABP followed by 1:500 streptavidin-Atto647N (#AD 647-61; ATTO-TEC GmbH, Germany), or 1:500 anti-Neurocan and 1:500 nanobody anti-mouse IgG conjugated to STAR635P (#N1202-Ab635P ...
-
No products found
because this supplier's products are not listed.
Susanne N. Walker, et al.,
bioRxiv - Immunology 2020
Quote:
... Followed by capture of SARS-CoV-2 receptor binding domain which was biotinylated using the lightning-link type-A biotinylation kit(Expedeon/Abcam, 370-0005) for 180s at 10ul/min ...
-
No products found
because this supplier's products are not listed.
Isabell Ramming, et al.,
bioRxiv - Microbiology 2023
Quote:
... the bound Stx of STEC culture supernatants was detected using a biotinylated detection antibody (MBS311734 for Stx1, MyBioSource Inc., San Diego, USA; 11E10, hybridoma cell line from American Type Culture Collection, Manassas ...
-
No products found
because this supplier's products are not listed.
Kourosh Kouhmareh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The labeled HA plus a combination of biotinylated monoclonal antibodies was mixed at a 1:16 ratio into phosphate buffered saline (PBS, 1X Caisson Labs PBL01-500ML) along with 0.1% Tween-20. ...
-
No products found
because this supplier's products are not listed.
Heather Swann, et al.,
bioRxiv - Biophysics 2020
Quote:
... followed by a brief dd-H20 wash to get rid of excess neutravidin and incubation with biotinylated anti-S antibody (11-2001-B, Abeomics, San Diego, CA, USA). Surfaces thus prepared were generally devoid of debris but sometimes had step-edge character suggesting that antibody coating was less than a full monolayer (Figure S4) ...
-
No products found
because this supplier's products are not listed.
Brian T. Analikwu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... we prepared mica substrates by punching 3.2 mm mica discs from mica sheets (V4 grade, SPI supplies) and gluing them to magnetic stainless steel discs with 2-component epoxy glue ...
-
No products found
because this supplier's products are not listed.
Chuyun Chen, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Mice were then anesthetized after receiving the substrates in a chamber with 2.5% isoflurane (RWD Life Science Co.) and placed on the imaging platform while being maintained on 2% isoflurane via a nose cone ...
-
No products found
because this supplier's products are not listed.
Sergei Pourmal, et al.,
bioRxiv - Biochemistry 2022
Quote:
... All three substrate-bound samples were blotted on Quantifoil R1.2/1.3 300-mesh Au Holey Carbon Grids (EMS). For all samples ...
-
No products found
because this supplier's products are not listed.
Marc Ramos-Llorens, et al.,
bioRxiv - Biochemistry 2024
Quote:
... All FA substrates (>98–99% pure) used for the functional characterisation assays were obtained from Nu-Chek Prep, Inc ...
-
No products found
because this supplier's products are not listed.
Washington Logroño, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The bottles were fed with gaseous substrate as described above and incubated at 37.4°C in an orbital shaking incubator (IKA KS 4000 ic control ...
-
No products found
because this supplier's products are not listed.
Daniel J. Steiner, et al.,
bioRxiv - Immunology 2020
Quote:
Arrays were printed on amine-reactive silicon oxide substrates (Adarza BioSystems, Inc.) using a Scienion SX piezoelectric microarrayer (Scienion, A.G.) with spot volumes of approximately 300 pL ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5 μL of caspase-3 substrate (1 mM in DMSO) and 0.5 μL of 1 M dithiothreitol (TCI, Cat#D1071)) ...
-
No products found
because this supplier's products are not listed.
S. John Liu, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Human Schwann cells (HSC) were cultured in complete Schwann Cell Medium on Poly-L-Lysine coated substrates (ScienCell Research Laboratories). HEI-193 schwannoma cells were cultured in Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum (FBS) ...
-
No products found
because this supplier's products are not listed.
Samuel Schmidt, et al.,
bioRxiv - Cell Biology 2020
Quote:
... incubated 24h at 4 °C) were used as substrates and prepared in Willco dishes (35 mm, Willco Wells B.V., HBSt-3522) as described46 ...
-
No products found
because this supplier's products are not listed.
Anupama Kante, Jeroen Roelofs, Eric J. Deeds,
bioRxiv - Biochemistry 2023
Quote:
... gels were rinsed in water for 10 mins and then transferred into activity assay buffer containing HNE (20mM HEPES, 300mM, 1mM EDTA, pH 7.0) and 50mM of the fluorogenic substrate Z-VLR AMC (Adipogen Life sciences). The gel was incubated in the activity assay buffer for 20 mins at 370C with intermittent shaking ...
-
No products found
because this supplier's products are not listed.
Haylie R. Helms, et al.,
bioRxiv - Bioengineering 2024
Quote:
GFP+ HUVEC and RFP+ MDA-MB-231 were printed onto a collagen type 1 substrate and in cultured in a 1:1 ratio of HUVEC media (VascuLife VEGF, Lifeline Cell Technology) and MDA-MB-231 media (DMEM + 10% FBS + 1% penicillin-streptomycin) ...
-
No products found
because this supplier's products are not listed.
Yilie Liao, et al.,
bioRxiv - Biochemistry 2021
Quote:
Primary hepatocytes were incubated with different substrates or inhibitors for 16-24 hours at following concentrations: 10mM glucose (Amresco, Cat#0188-500G); 4mM glutamine (Gibco ...
-
No products found
because this supplier's products are not listed.
Haixia Zhu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
MST experiments to measure the binding affinities between TadAs and the 19-nt DNA substrate were performed on a Monolith NT.115 system (NanoTemper Technologies, Germany) using the nano BLUE detector ...
-
No products found
because this supplier's products are not listed.
Olivia Bulka, et al.,
bioRxiv - Microbiology 2023
Quote:
... was added to the reaction buffer and the respective substrates were suppled to a final concentration of 0.5 mM using saturated water stocks and glass syringes (Hamilton Company, Reno, NV). Once the substate was added ...
-
No products found
because this supplier's products are not listed.
Sándor Váczi, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The examined enzyme reaction started after pipetting the tracer substrate 1-14C-AA (3.7 kBq, 0.172 nM in each sample; American Radiolabeled Chemicals, Inc., St Louis, MO 63146 USA) into the incubation mixture ...
-
Peptide to Transglutaminase Substrate biotinylated
Cat# CCP2945,
1 mg USD $150.0, 5 mg USD $375.0, 10 mg USD $563.0
No citation found on bioRxiv
-
Transglutaminase Substrate, biotinylated is a peptide.
Cat# abx265629-25MG,
25 mg USD $783.0
No citation found on bioRxiv
-
This enzyme belongs to the family of transferases, specifically those transferring...
Cat# NATE-1725,
100 ug, contact supplier for pricing
No citation found on bioRxiv
-
Catalog Number: B2011148 (1 mg)
MBP MAPK Substrate Biotinylated is a high quality...
Cat# B2011148,
USD $495.0
No citation found on bioRxiv
-
No citation found on bioRxiv
-
Cat# 300711-04-0,
Inquire
No citation found on bioRxiv