-
No products found
because this supplier's products are not listed.
Sumnima Singh, et al.,
bioRxiv - Immunology 2020
Quote:
... incubated with biotinylated anti-mouse C1q (Cedarlane #CL7501B ...
-
No products found
because this supplier's products are not listed.
Teha Kim, et al.,
bioRxiv - Immunology 2023
Quote:
... The plates were blocked with PBS containing 1% BSA for 1 hour at room temperature before the specified biotinylated IgG1 M2e-MAbs or biotinylated IgG1 control MAbs (Clone: MOPC-21, BioXCell) diluted in PBS 0.1% Tween 20 (PBS-T ...
-
No products found
because this supplier's products are not listed.
Vishal R. Patel, et al.,
bioRxiv - Biophysics 2021
Quote:
... and 1 ug/mL biotinylated GFP-nanobody (ChromoTek). All solutions were made in a buffer that consisted of phosphate buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Michael H. Zhang, et al.,
bioRxiv - Immunology 2019
Quote:
... and their biotinylated variants were purchased from Tocris Bioscience and InvivoGen ...
-
Cat# PR-29bt,
500 micrograms,USD $420.0
Ask
Yang Su, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Biotinylated M25 IgG1 and Streptavidin-ZAP (Advanced Targeting Systems) were mixed at a molar ratio of 1:1 on ice for 30 min and added to cells at final concentration of SA-ZAP at 0 ...
-
No products found
because this supplier's products are not listed.
Leïla Dumas, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 0.75 mM biotinylated UTP (Biotin-16-UTP, Lucigen BU6105H) and either 7.5 mM GTP or 6.75 mM 7-deazaguanine (TriLink N-1044 ...
-
No products found
because this supplier's products are not listed.
Chungwon Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or the biotinylated anti-VGAT antibody (131 103CpH, Synaptic Systems) was conjugated to streptavidin-conjugated quantum dots (cat ...
-
No products found
because this supplier's products are not listed.
Ivan Corbeski, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The co-substrate SAM (Cisbio, 62SAHZLD) (450 nM final concentration ...
-
No products found
because this supplier's products are not listed.
Aaron M. Rosado, et al.,
bioRxiv - Biophysics 2022
Quote:
... freshly isolated human RBCs were biotinylated with biotin-PEG3500-NHS (Jenkem Technology) and then incubated with nystatin in N2 buffer (265.2 mM KCl ...
-
No products found
because this supplier's products are not listed.
Maria Georgiou, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Proteasome substrate Bz-VGR-AMC (BW9375, Biomol International) was used to measure the trypsin like activity of the proteasome ...
-
No products found
because this supplier's products are not listed.
Brennan J Wadsworth, et al.,
bioRxiv - Physiology 2023
Quote:
... Knockdown experiments used dicer-substrate siRNA (IDT DNA) against BCKDHA ...
-
No products found
because this supplier's products are not listed.
B. H. Abuaita, et al.,
bioRxiv - Immunology 2019
Quote:
... CASPASE-2 FAM-VDVAD-FMK FLICA substrate (ImmunoChemistry Technologies) for 1h at 37°C or 2 μM CellEvant CASPASE-3/7 Green detection reagent (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Chung-Young Lee, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 0.3125 μg/mL) biotinylated glycan 3’SLN-PAA and 6’SLN-PAA (Carbosynth, USA) in PBS were added to the wells of streptavidin-coated high binding capacity 96-well plates (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Hana Majaron, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Pelcotec™ SFG12 Finder Grid Substrate- Si wafers (Ted Pella), Aeroneb®Pro nebulizer (from VITROCELL® Cloud 6 system) ...
-
No products found
because this supplier's products are not listed.
Ria Lassaunière, et al.,
bioRxiv - Immunology 2023
Quote:
... A 100 μL TMB One Substrate (Cat. # 4380, KemEnTec, Denmark) was added and incubated for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Shataakshi Dube, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The supernatant with eluted biotinylated proteins was carefully transferred to a low-protein-binding tube (Eppendorf) with a 30g needle and stored at −80°C.
-
No products found
because this supplier's products are not listed.
Madeline Loffredo, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... in a kinetic assay using the fluorogenic substrate Ubiquitin-AMC (Boston Biochem, Inc ...
-
No products found
because this supplier's products are not listed.
Yongfan Men, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... the PCR substrate was transferred to an inverted fluorescence microscope (IX71, Olympus) for imaging ...
-
No products found
because this supplier's products are not listed.
Naoki Onoda, et al.,
bioRxiv - Microbiology 2020
Quote:
... the solution was mixed with the chromogenic substrate (S-2302, 0.5 mM; Chromogenix) in HEPES-NaHCO3 buffer (9) ...
-
No products found
because this supplier's products are not listed.
Geoffrey T. Norris, et al.,
bioRxiv - Immunology 2023
Quote:
... biotinylated ST2 (101001B; MD Bioscience), Streptavidin R-Phycoerythrin (S21338 ...
-
No products found
because this supplier's products are not listed.
Paweł P. Knejski, et al.,
bioRxiv - Biochemistry 2023
Quote:
... except using biotinylated A8-35 (Anatrace), was used to reconstitute refolded PhuR into biotinylated amphipols for phage display.
-
No products found
because this supplier's products are not listed.
Debolina Ganguly, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Opal substrates (Akoya Biosciences ...
-
No products found
because this supplier's products are not listed.
Andrew McEwan, et al.,
bioRxiv - Genetics 2020
Quote:
... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
No products found
because this supplier's products are not listed.
William S. Lawrence, et al.,
bioRxiv - Microbiology 2023
Quote:
... Biotinylated recombinant PA83 (List Biological Labs, Campbell, CA) was bound to streptavidin-coated plates (MesoScale Discovery ...
-
No products found
because this supplier's products are not listed.
Rick G. Kim, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Biotinylated peptides were searched using exogenous biotin (ExBio) on lysine as a variable modification ...
-
No products found
because this supplier's products are not listed.
Tingting Li, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Biotinylated RBDavi was bound to streptavidin (Cat 16955, AAT Bioquest) which was fluorescently labeled by fluorescein via amine coupling ...
-
No products found
because this supplier's products are not listed.
Aubin Ramon, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The loading wells contained 50 nM of biotinylated β2-microglobulin or 30 nM of biotinylated SarS-CoV-2 RBD (purchased from CUSABIO, product code CSB-MP3324GMY1-B). All experiments consisted in a baseline step ...
-
No products found
because this supplier's products are not listed.
Xuan Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The luciferase substrate coelenterazine-h (Prolume) was added to a final concentration of 5 μM and the plate incubated for 10 min at 37°C protected from light.
-
No products found
because this supplier's products are not listed.
Anne-Perrine Foray, et al.,
bioRxiv - Immunology 2021
Quote:
... IFNγ was detected using biotinylated anti-IFNγ capture antibody (U-CyTech Biosicences), alkaline phosphatase conjugated ExtrAvidin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
A.T. Nelson, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 2) biotinylated anti-GP polyclonal detector antibody (Proteintech 24494-1-AP). After washing steps ...
-
No products found
because this supplier's products are not listed.
Pau Guillamat, et al.,
bioRxiv - Biophysics 2020
Quote:
Substrate preparation: a glass bottom dish (Mattek) was first activated with a plasma cleaner (Harrick Plasma ...
-
No products found
because this supplier's products are not listed.
Side Hu, et al.,
bioRxiv - Biochemistry 2021
Quote:
Substrate peptides were synthesized by Bio Basic and consist of an N-terminal substrate PIE(EDANS)YNAL and C-terminal substrate GIK(DABSYL)SIP ...
-
No products found
because this supplier's products are not listed.
Du-San Baek, et al.,
bioRxiv - Immunology 2022
Quote:
... Biotinylated HLA-E *01:01(peptide sequence: VMAPRTLVL) was purchased from MBL international and it was complexed with streptavidin-HRP in 4:1 molar ratio then 100 pM of tetramer was used for competitive ELISA.
-
Cat# HY-114315-10 mM * 1 mL,
10 mM * 1 mL, USD $495.0
Ask
Longxi Zhou, et al.,
bioRxiv - Plant Biology 2023
Quote:
... The biotinylated probes were first incubated with Streptavidin Magnetic Beads (MedChemExpress, HY-K0208) in Buffer I (1 M NaCl ...
-
No products found
because this supplier's products are not listed.
Carina Conzelmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... the TMB peroxidase substrate (Medac #52-00-04) was added ...
-
No products found
because this supplier's products are not listed.
Christopher D. Kegelman, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and diaminobenzidine substrate chromogen system (329ANK-60; Innovex Biosciences), which allowed for immunohistochemical detection of positively stained cells ...
-
No products found
because this supplier's products are not listed.
Kerstin Wernike, et al.,
bioRxiv - Microbiology 2020
Quote:
... Following the addition of tetramethylbenzidine (TMB) substrate (IDEXX, Switzerland), the ELISA readings were taken at a wavelength of 450 nm on a Tecan Spectra Mini instrument (Tecan Group Ltd ...
-
No products found
because this supplier's products are not listed.
Ankit Rai, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Biotinylated poly(l-lysine)-[g]-poly(ethylene glycol) (PLL-PEG-biotin) was obtained from Susos AG ...
-
No products found
because this supplier's products are not listed.
EmilyClare P. Baker, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... and visualized by WesternBright™ ECL HRP Substrate (Thomas Scientific). For pulldowns visualized by western blotting CEACAM1 protein input samples were prepared by mixing 20uL of protein with 20uL 2x Laemmli then boiled at 95°C for five minutes and centrifuged at max speed for five minutes ...
-
No products found
because this supplier's products are not listed.
Alessandro Gori, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The detector antibody (biotinylated CD9, CD63, CD81 antibodies by Ancell or anti-band 3 from Santa Cruz) solutions (0.3 µg/ml ...
-
No products found
because this supplier's products are not listed.
Shubhangini Tiwari, et al.,
bioRxiv - Neuroscience 2022
Quote:
... the immunoblots were incubated with Femto Lucent plus HRP substrate (G-Biosciences) and visualized under ChemiDoc XRS+ (Biorad) ...
-
No products found
because this supplier's products are not listed.
Zhaowei Xu, et al.,
bioRxiv - Microbiology 2021
Quote:
... and printed in triplicate on PATH substrate slides (Grace Bio-Labs, Oregon, USA) to generate identical arrays in a 2 × 7 subarray format using a Super Marathon printer (Arrayjet ...
-
No products found
because this supplier's products are not listed.
E.E. Van Haaften, et al.,
bioRxiv - Bioengineering 2020
Quote:
... the supernatants were consecutively incubated with antibody-conjugated MagPlex microspheres (1 h), biotinylated antibodies (1 h), and streptavidin-phycoerythrin (10 min, diluted in high performance ELISA (HPE) buffer (Sanquin)) ...
-
No products found
because this supplier's products are not listed.
Xavier Montagutelli, et al.,
bioRxiv - Microbiology 2021
Quote:
... Plates were revealed by adding 100 μl of HRP chromogenic substrate (ABTS solution, Euromedex) after PBST washings ...
-
No products found
because this supplier's products are not listed.
Eleftheria Babaliari, et al.,
bioRxiv - Bioengineering 2020
Quote:
... the substrates were transferred into sterile wells of 24-well plates (Sarstedt, Numbrecht, Germany) for static cultures or/and inside the chambers of the microfluidic system for dynamic cultures ...
-
No products found
because this supplier's products are not listed.
Shimon Yudovich, et al.,
bioRxiv - Biophysics 2021
Quote:
... substrates were further treated under a glow discharge system (Emtech K100x; Quorum Technologies, Sussex, UK) for a total of 5 minutes ...
-
No products found
because this supplier's products are not listed.
Kai Weißenbruch, et al.,
bioRxiv - Biophysics 2021
Quote:
Images of immunolabeled samples on cross-patterned substrates were taken on an AxioimagerZ1 microscope (Carl Zeiss, Germany). To obtain high resolution images of minifilaments ...
-
No products found
because this supplier's products are not listed.
Jakob Vinje, et al.,
bioRxiv - Biophysics 2021
Quote:
Substrates for EBL were prepared directly after HMDS treatment by spin coating SU-8 2001 (Microchem Corp.) to a desired thickness of 500 nm and 1000 nm ...
-
No products found
because this supplier's products are not listed.
Jonathan H. Shrimp, et al.,
bioRxiv - Biochemistry 2022
Quote:
... was added Cbz-SKPSKRSFIED substrate (2.5 mM, 200 nL, 250x) and inhibitor (200 nL, 250x) using an ECHO 655 acoustic dispenser (LabCyte). To that was dispensed TMPRSS2 (reconstituted in 50% glycerol at 8.75 μM ...
-
No products found
because this supplier's products are not listed.
David Eriksson, et al.,
bioRxiv - Neuroscience 2021
Quote:
... As the implantation proceeded parts of the substrate was melted away with a standard cauterizer (Bovie, WPI, Germany, Friedberg). The 3D printed substrate had a two-step staircase ...