1 - 50 of 204
suppliers found for
Toxoplasma gondii IgG antigen RH strain
» view 6295 matched products-
The Native Antigen Company Sponsored
-
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2016, published in Molecular Biology Of The Cell doi: 10.1091/mbc.E16-08-0587Quote: ... gondii RH strain total RNA by SuperScriptII RT (Invitrogen, Carlsbad, CA) using reverse primer AS1 ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in PeerJ doi: 10.7717/peerj.7215Quote: ... gondii RH strain using TRIsoln (Merck Genei). The cDNA for TgTPx1/2 was generated using gene specific reverse primers TPx1/2R by RevertAid Reverse Transcriptase (Thermo Scientific) ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019Quote: ... Extracellular parasites were stained with mouse anti-Toxoplasma antigen B1247M (Abcam) 1:1000 and goat anti-mouse Alexa Fluor 488 ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... gondii (RH-LDM) were sorted (FACS Aria Fusion, BD Biosciences) based on GFP-expression and CD56 expression ... -
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0215192Quote: ... were loaded with Rh-123 (Sigma-Aldrich) at a final concentration of 1 μg/mL for 30 min on ice ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Pathology 2020Quote: ... Antigen retrieval was performed using Antigen Retrieval Solution (DAKO) at >98°C in steamer ... -
New England Biolabs
No products found because this supplier's products are not listed.Cited in IgG is differentially and selectively transferred across the placenta in HIV-infected womenbioRxiv - Microbiology 2018Quote: ... Adsorbed plasma samples were removed and antigen-specific IgG bound to the antigen-coupled beads was digested with IDEZ (New England Biolabs) at 37°C for 1 hour in rotation ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in The Journal of Neuroscience doi: 10.1523/JNEUROSCI.2936-19.2020Quote: ... Antigen retrieval was performed using Antigen Unmasking Solution (Vector Laboratories) at 80°C for 30 minutes ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2017, published in Journal of Cell Biology doi: 10.1083/jcb.201703145Quote: One female day 70 mouse of the Mouse Mammary Tumor Virus-Polyoma Middle T Antigen strain (MMTV-PyMT, Jackson Laboratories) was sacrificed and the largest mammary tumor from each inguinal mammary gland was surgically excised ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2020Quote: ... Antigen on the membrane was visualized with horseradish peroxidase-coupled anti-rabbit IgG (Promega) for VHA-a1 and VHA-a3 ... -
Charles River Labs
No products found because this supplier's products are not listed.bioRxiv - Immunology 2018Quote: ... gondii cysts were maintained in chronically infected (1-6 months) Swiss Webster (Charles River) mice ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2018, published in Molecular Biology and Evolution doi: 10.1093/molbev/msy060Quote: ... Yeast strain Y187 (Clontech) was used to generate six bait strains carrying overlapping fragments of the ZmC4-NADP-ME (GRMZM2G085019 ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020, published in Antimicrobial Agents and Chemotherapy doi: 10.1128/AAC.00535-20Quote: ... CH-ME49 cysts and RH strain tachyzoites using the DNeasy Blood % Tissue Purification Kit (Qiagen). The cytochrome b coding sequences were amplified from genomic DNA and cDNA by PCR with primers 5’ATGGTTTCGAGAACACTCAGT ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020, published in Science Advances doi: 10.1126/sciadv.aba5031Quote: ... pSBtet-RH (Addgene # 60500) were gifts to Addgene from Eric Kowarz 77 ... -
SouthernBiotech
No products found because this supplier's products are not listed.Cited in IgG is differentially and selectively transferred across the placenta in HIV-infected womenbioRxiv - Microbiology 2018Quote: ... Maternal and infant plasma HIV and vaccine antigen-specific IgG was detected with a mouse anti-human IgG (Southern Biotech, Birmingham, AL) phycoerythrin-conjugated antibody at 2µg/ml as described previously (Tomaras et al. ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019Quote: ... The calculation of IgG antibody concentration against each individual influenza virus strain rHA was performed by Bio-Plex Manager™ 6.2 software (Bio-Rad Co., CA). -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Genetics 2018, published in PLOS Genetics doi: 10.1371/journal.pgen.1007765Quote: ... Anti-Proliferating Cell Nuclear Antigen (PCNA) was from Santa Cruz Biotechnology ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in International Journal of Cancer doi: 10.1002/ijc.32603Quote: ... on an EDB antigen-coated sensor chip (CM5, GE Healthcare). -
Jackson ImmunoResearch
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... Serum Ms-IgG and Ms-IgG-Fab were purchased from Jackson ImmunoResearch. Fluorescent conjugated antibodies used for flow cytometry included ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in Scientific Reports doi: 10.1038/s41598-020-57645-zQuote: ... and Ly-6G (neutrophils) antigens (Cat# 127609, Biolegend, US) (1:1,000 in PBS-T plus 1% BSA ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... including proliferating cell nuclear antigen (PCNA) (cat#2586S, Cell Signaling Technology, Boston, MA), H2A histone family member X (H2AX)(cat#7631S ... -
Rockland
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ... using saturated salt solutions of KCl (85% RH) or MgCl2 (33% RH) (Rockland, 1960). -
ImmunoTools
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... rh BAFF (50 ng/mL, Immunotools), rh IFN-α2a (10 ng/mL ... -
American Type Culture Collection
No products found because this supplier's products are not listed.Cited in Revisiting the role of Toxoplasma gondii ERK7 in the maintenance and stability of the apical complexbioRxiv - Microbiology 2021Quote: ... gondii were grown in human foreskin fibroblasts (HFFs, American Type Culture Collection-CRL 1634) in Dulbecco’s Modified Eagle’s Medium (DMEM ... -
LI-COR
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2018, published in Biogeochemistry doi: 10.1007/s10533-019-00574-5Quote: We measured RH with a LICOR 6400 soil CO2 flux chamber (LI-COR Biosciences, Inc. Lincoln, NE, USA), in small PVC collars (10 cm in diameter and 5 cm in height ... -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2018Quote: ... FLS2 (antigen: CTKQRPTSLNDEDSQ; Genscript), RFP (MBL International ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2018, published in Cell doi: 10.1016/j.cell.2019.06.032Quote: Anti-digoxigenin antigen-binding fragments (Fab) (Roche) were resuspended in 0.1 M NaHCO3 pH 8.3 at 10 mg/mL ... -
Biocare Medical
No products found because this supplier's products are not listed.Cited in Transcription factors NFIA and NFIB induce cellular differentiation in high-grade astrocytomabioRxiv - Cancer Biology 2019, published in Journal of Neuro-Oncology doi: 10.1007/s11060-019-03352-3Quote: ... Antigen retrieval was performed using an antigen decloaking chamber (Biocare Medical, Pacheco, California). Mounted sections were heated to 125°C for 4 minutes at 15 psi in 10 mM sodium citrate buffer (pH 6.0 ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Evolutionary Biology 2020, published in eLife doi: 10.7554/eLife.55336Quote: ... pretoriensis strain CBS2187T (Illumina, PE 2 x 100 bp + 6 kb library MP 2 x 100 bp ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Genomics 2018Quote: ... 500 units/ml of rh IL-2 (Corning), and 10% human serum ... -
Lucigen
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2018, published in Cell doi: 10.1016/j.cell.2018.10.021Quote: ... coli strain TG1 (Lucigen) was used for all of the DNA cloning steps ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2018, published in PLOS ONE doi: 10.1371/journal.pone.0198978Quote: ... The EpCAM antigen (R&D systems, Minneapolis, MN) was immobilized onto the surface of a GLC sensor chip and stabilized with PBS-T buffer (PBS buffer containing 0.05% v/v Tween-20) ... -
Zymo Research
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2017, published in ACS Synthetic Biology doi: 10.1021/acssynbio.8b00493Quote: ... and a JM109 strain (Zymo Research) for all other constructs ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020, published in Communications Biology doi: 10.1038/s42003-020-01479-yQuote: ... The immunostaining for all antigens was performed on an automated staining system (Leica Bond RX ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2017Quote: ... Typhimurium strain XEN26 (PerkinElmer, 119230), anesthetized with isoflurane ... -
BestGene
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in Development doi: 10.1242/dev.176529Quote: ... The transgenic strains were injected by BestGene Inc ... -
Bethyl
No products found because this supplier's products are not listed.Cited in Heparan sulfates are critical regulators of the inhibitory megakaryocyte-platelet receptor G6b-BbioRxiv - Biochemistry 2019, published in eLife doi: 10.7554/eLife.46840Quote: ... Purified human IgG-Fc fragment (IgG-Fc) was from Bethyl Laboratories ... -
Bio X Cell
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019Quote: ... Rat-IgG (2A3, BioXcell) and Hamster-IgG (Life Technologies ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2018, published in Science Advances doi: 10.1126/sciadv.aau6769Quote: ... each mouse was immunized with 200 μl of antigen/adjuvant mix containing 50 μg of antigen and 100 μl AddaVax adjuvant (Invivogen) or 50 μl PIKA adjuvant (Yisheng Biopharma ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in Cell doi: 10.1016/j.cell.2020.03.062Quote: ... in a 2100 Antigen Retriever system (Electron Microscopy Sciences). Sections were then incubated with dual endogenous peroxidase block (Dako ... -
Dianova
No products found because this supplier's products are not listed.Cited in Lamellipodin tunes cell migration by stabilizing protrusions and promoting adhesion formationbioRxiv - Cell Biology 2019, published in Journal of Cell Science doi: 10.1242/jcs.239020Quote: ... Peroxidase-coupled anti-mouse IgG or anti-rabbit IgG secondary antibodies were purchased from Dianova GmbH (Germany). -
Mabtech
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019Quote: ... Antigen-specific IgG ELISpot assays were performed using Human IgG ELISpotBASIC kit (MabTech). PBMCs were first pre-stimulated with a mixture of R848 at 1 μg/ml and rhIL-2 at 10 ng/ml for 96h ... -
Miltenyi Biotec
No products found because this supplier's products are not listed.bioRxiv - Immunology 2018Quote: ... MACS GMP PepTivator EBV Select (antigens: proprietary mix of 13 antigens, Miltenyi Biotec), and HHV6 U90 (JPT Peptide Technologies). -
Ted Pella
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2019, published in eLife doi: 10.7554/eLife.49806Quote: ... carbon film supported by a Maxtaform 400 mesh Cu/Rh grid (TED PELLA). After incubation for 45 s ... -
Quantifoil Micro Tools
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in Nature Communications doi: 10.1038/s41467-020-14350-9Quote: ... R 2/1 or R 3.5/1 on 300 mesh Cu/Rh grids (QUANTIFOIL) were glow discharged for 45 s at 25 mA ... -
Proteintech
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2019, published in Science China Chemistry doi: 10.1007/s11426-019-9656-7Quote: ... Goat anti-Rabbit IgG HRP conjugate and negative control Rabbit IgG were purchased from ProteinTech Group (Wuhan ... -
Beckman
No products found because this supplier's products are not listed.bioRxiv - Immunology 2018, published in Journal of Virology doi: 10.1128/JVI.00895-18Quote: ... Anti-HIV-1 core antigen antibody (KC57-RD1, Beckman Coulter) was used to stain intracellular HIV-1 gag protein ... -
Teknova
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2017, published in ACS Synthetic Biology doi: 10.1021/acssynbio.7b00112Quote: ... strains were grown in standard LB (Teknova) supplemented with kanamycin (Fisher ... -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2018Quote: ... All strains were cultured in YE or EMM (MP Biomedicals) media with necessary supplements ... -
Boster
No products found because this supplier's products are not listed.bioRxiv - Zoology 2018Quote: ... The antigen-antibody reaction for immunohistochemical staining was performed using a standard avidin-biotin-peroxidase complex technique (IHC kit, Boster, China), and PBS was used as a negative control.