-
No products found
because this supplier's products are not listed.
Emily Nestor Truckenbrod, et al.,
bioRxiv - Immunology 2020
Quote:
... a toll-like receptor 3 agonist (InvivoGen). Peptide doses of 50 ...
-
No products found
because this supplier's products are not listed.
Hyeongjwa Choi, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... rabbit anti-Toll-like Receptor 3 (#6961, Cell Signaling Technology), mouse anti-Lamin A/C (sc-376248 ...
-
No products found
because this supplier's products are not listed.
Leandra B. Jones, et al.,
bioRxiv - Microbiology 2020
Quote:
... Toll-like Receptor (TLR) 4 (Thermo Fisher Scientific, Waltham, MA, USA, 1:2000), TLR7 (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Emilio Boada-Romero, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-Toll-like receptor 2 (anti-TLR2; Clone T2.5 for flow cytometry, Biolegend 121810 ...
-
No products found
because this supplier's products are not listed.
Daniela Farkas, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... human TLR3 (forward: FH2-TLR3; CAACAGAATCATGAGACAGAC; reverse: RH2-TLR3; CACTGTTATGTTTGTGGGTAG; Millipore Sigma), GUSB (forward ...
-
No products found
because this supplier's products are not listed.
Giulia A. Corbet, et al.,
bioRxiv - Cell Biology 2022
Quote:
... TLR3 (Abcam ab137722), NLRP1 (Abcam ab36852) ...
-
No products found
because this supplier's products are not listed.
Makoto Nishimori, et al.,
bioRxiv - Biochemistry 2023
Quote:
... SKF81297 hydrobromide (D1-like receptor agonist, TOCRIS), quinpirole hydrochloride (D2-like receptor agonist ...
-
No products found
because this supplier's products are not listed.
Huan Wang, et al.,
bioRxiv - Biochemistry 2021
Quote:
... anti-toll-like receptor-4 (TLR-4) (Santa Cruz Biotechnology, USA, sc-293072), anti-nuclear factor kappa-B (NFκB ...
-
No products found
because this supplier's products are not listed.
Marie-France Dorion, et al.,
bioRxiv - Neuroscience 2023
Quote:
... or anti-toll-like receptor 4 (TLR4; clone #610029, R&D Systems). All antibodies were titrated using negative control cells that don’t or poorly express the target protein ...
-
No products found
because this supplier's products are not listed.
Mathilde Barthe, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... 10 Toll-Like Receptors (TLRs; Velová et al.,2018) and 9 Beta Defensins (BD; Chapman et al., 2016). The Database group included genes identified by Immunome Knowledge Base (Ortutay and Vihinen ...
-
No products found
because this supplier's products are not listed.
Yi Huang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and ligand for fms-like tyrosine kinase receptor-3 (10ng/ul) (Peprotech), followed by two rounds of spinoculation (2,530rpm ...
-
No products found
because this supplier's products are not listed.
Marijke I. Zonneveld, et al.,
bioRxiv - Immunology 2020
Quote:
... cDNA was added to the Human Toll-like receptor signaling pathway RT2 Profiler PCR array (Qiagen) and run on an iCycler MyiQ (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Jia Gu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Antibody to high mobility group box 1 (anti-HMGB1, 66525-1-Ig) and toll-like receptor 4 (anti-TLR4, 19811-1-AP) were purchased from Proteintech. Antibody to nuclear factor kappa B p65 (anti-NF-κB ...
-
No products found
because this supplier's products are not listed.
Rory Henderson, et al.,
bioRxiv - Immunology 2023
Quote:
... The synthetic Toll-like receptor 7/8 agonist 3M-052 absorbed to ALUM (3M-052-ALUM) was used as the adjuvant for the vaccine immunogens ...
-
No products found
because this supplier's products are not listed.
María de los Ángeles de Pedro, et al.,
bioRxiv - Cell Biology 2021
Quote:
Different lineages of in vitro cultured endMSCs (n = 3) were primed using a combination of recombinant pro-inflammatory cytokines and Toll-like receptors (TLR) ligands: IFNγ (Miltenyi Biotec Inc, San Diego, CA, USA) at 1 ng/ml and 100 ng/ml ...
-
No products found
because this supplier's products are not listed.
Woojong Lee, et al.,
bioRxiv - Immunology 2020
Quote:
... Trypsin-Like and Caspase-Like Cell-Based Assays (Promega), according to manufacturer’s instructions (Moravec et al. ...
-
No products found
because this supplier's products are not listed.
Meghan Robinson, et al.,
bioRxiv - Bioengineering 2021
Quote:
... anti-Insulin Like 3 (INSL3, Novus Biologicals, NBP1-81223) 1:500 ...
-
No products found
because this supplier's products are not listed.
Yuta Nakazawa, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... a TLR3/dsRNA complex inhibitor (Merck) and a TLR4 inhibitor (TAK-242 ...
-
No products found
because this supplier's products are not listed.
Mara Klöhn, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Successful differentiation into cholangiocyte-like and hepatocyte-like cells was tested validated by immunostaining against albumin (Agilent, Cat. Nr. A0001). Primary human hepatocytes (PHHs ...
-
No products found
because this supplier's products are not listed.
Eva Pérez-Guijarro, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Fc receptors were blocked with anti-CD16/32 antibody (2.4G2, Bioxcell) and the following anti-mouse antibodies were used ...
-
No products found
because this supplier's products are not listed.
Marisol Sampedro-Castañeda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... muscarinic receptor type 3/1 (CHRM3/1, Addgene) and GFP were co-expressed at a ratio of 8:4:3:1 ...
-
No products found
because this supplier's products are not listed.
William N. Grimes, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Glycine receptor alpha1 specific monoclonal antibody from Synaptic Systems was utilized and whole mount labeling were performed according to the procedure described above ...
-
No products found
because this supplier's products are not listed.
Simone Köhler, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mEos2::HIM-3 was co-stained with a rabbit anti-HIM-3 antibody and a donkey-anti-rabbit secondary antibody (Jackson ImmunoResearch) labelled with CF568-NHS ester to achieve a 2:1 dye-to-antibody ratio ...
-
No products found
because this supplier's products are not listed.
Liza Esther Alexander, et al.,
bioRxiv - Biochemistry 2020
Quote:
... ZmGl2-like sequence was initially obtained from GenScript as a pUC57-clone and was sub-cloned into pENTRTM/D-TOPO® entry vector (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Minji Park, et al.,
bioRxiv - Microbiology 2020
Quote:
... TLR3-/- (B6;129S1-Tlr3tm1Flv/J, 005217) mice were obtained from Jackson Laboratory (Bar Harbor, ME, USA). All animal experimental procedures were reviewed and approved by the Institutional Animal Care and Use Committee of Hanyang University (protocol 2018-0085 ...
-
No products found
because this supplier's products are not listed.
Dhanu Gupta, et al.,
bioRxiv - Bioengineering 2020
Quote:
... anti-CD63 and anti-CD81 detection antibodies (supplied in the MACSPlex kit, 5 µl each) or anti-decoy receptor antibodies (AlexaFluor647-labelled anti-human TNFR1, Bio-Rad, cat #MCA1340A647 ...
-
No products found
because this supplier's products are not listed.
Antonella Raffo-Romero, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... progesterone receptor (PR) (790–4296, Roche) and human epidermal growth factor 2 (HER-2 ...
-
No products found
because this supplier's products are not listed.
Abdullah O. Khan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... recombinant Fms-like tyrosine kinase-3 (Flt3, StemCell Technologies Cat#78009), Erythropoeitin (EPO ...
-
No products found
because this supplier's products are not listed.
Hiroshi Arai, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... magnanima was assessed by PCR amplifying a cifB-like gene (Extended Data Table 3) in the WOwHm-t76 region with the Emerald Amp Max Master mix (TaKaRa) at 94°C for 3 min ...
-
No products found
because this supplier's products are not listed.
Natasha Malik, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... by inoculating cre+-Raptorfl/fl mice with 10 mg/kg TLR3 agonist poly(I:C) once every two days as indicated (GE Healthcare, WI) to induce Raptor cKO in the mouse ...
-
No products found
because this supplier's products are not listed.
Kevin B. Koronowski, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Primary antibodies (Anti-3-hydroxybutyryllysine [PTM Biolabs 1201] ...
-
No products found
because this supplier's products are not listed.
John P. Snow, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Defined iPSC-like colonies were manually isolated 3-4 weeks post-transfection and expanded on Matrigel (Corning) in mTeSR1 (StemCell Technologies) ...
-
No products found
because this supplier's products are not listed.
Wojciech P. Michno, et al.,
bioRxiv - Neuroscience 2023
Quote:
... +/- 10 uM ADM22-52 (the RAMP2/3 receptor blocker (Cayman Chemical Company, cat. no. 24892)) ...
-
No products found
because this supplier's products are not listed.
Christopher Cyrus Kuhn, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Bound integrins were quantified by an enzyme-linked immunosorbent (ELISA)-like solid-phase assay using biotinylated rabbit anti-velcro (against ACIS/BASE coiled-coil) antibody and HRP-conjugated streptavidin (VECTOR Laboratories #SA-5004). After addition of ABTS ...
-
No products found
because this supplier's products are not listed.
Jennifer M. Luppino, et al.,
bioRxiv - Genetics 2022
Quote:
... IRDye 800CW Goat anti-Mouse IgG Secondary Antibody (LI-COR, 3:10,000).
-
No products found
because this supplier's products are not listed.
Jibin Guan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The membranes were probed with primary antibodies to the androgen receptor (GeneTex, Irvine, CA) and β-actin (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Lei An, et al.,
bioRxiv - Genetics 2021
Quote:
... Total EGF Receptor (10001-R021) and anti-EGFR-PE (352904) antibodies were purchased from Sino Biological (China) and BioLegend (USA) ...
-
No products found
because this supplier's products are not listed.
Yanchun Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... The rabbit polyclonal antibodies against the peptide corresponding to 807-1068 aa of the Toll (XM_016911914.1) was synthesized by ABclonal Technology and got the 2 mg/mL purified antigen through Ni-IDA (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Nandini Rangaraj, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mouse monoclonal anti-transferrin receptor antibody was from Calbiochem (#GRO9L); anti-mouse and anti-rabbit Cy3 conjugated secondary antibodies were from Amersham ...
-
No products found
because this supplier's products are not listed.
Adam J. Wolpaw, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Myc-DDK-PRRX1a and Myc-DDK-TLR3 were purchased from Origene (RC213276, RC210497). TLR3 was transfected using Lipofectamine™ 3000 and selected with G418 ...
-
No products found
because this supplier's products are not listed.
Coralie Zangarelli, et al.,
bioRxiv - Genomics 2022
Quote:
... Phosphate Buffered Saline-like (Puraflow Sheath Fluid, Beckman Coulter) was used as sheath and run at a constant pressure of 10 or 25 PSI ...
-
No products found
because this supplier's products are not listed.
Kevin J. McNaught, et al.,
bioRxiv - Molecular Biology 2020
Quote:
H3K27me2/3 ChIP using anti-H3K27me2/3 antibody (Active Motif, 39536) was performed as previously described (12 ...
-
No products found
because this supplier's products are not listed.
Cristina Aguirre-Portolés, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... five-micron sections of formalin-fixed paraffin-embedded tissue were stained using antibody against Androgen Receptor [(Leica AR-318-L-CE ...
-
No products found
because this supplier's products are not listed.
Talia Hatkevich, et al.,
bioRxiv - Genetics 2020
Quote:
Antibodies for C(3)G (25) and g-H2Av (Rockland) were used ...
-
No products found
because this supplier's products are not listed.
Alix Warburton, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Antibodies used were Brd4 (Bethyl Laboratories A301-985A, 3 μg) or H3K27ac (Millipore 07–360 ...
-
No products found
because this supplier's products are not listed.
Yingying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rabbit anti-immunoglobulin like domain containing receptor 1 (ILDR1) (Antibodies-online.com, 1:200, Cat # ABIN1386369), (6 ...
-
No products found
because this supplier's products are not listed.
Thomas B Rundell, et al.,
bioRxiv - Genetics 2023
Quote:
The muscarinic receptor antagonist atropine ((RS)-(8-Methyl-8-azabicyclo[3.2.1]oct-3-yl, VWR Cat. TCA0754-005G) was dissolved in ethanol and added to 1M (HS ...
-
No products found
because this supplier's products are not listed.
Laurel R. Yohe, et al.,
bioRxiv - Genomics 2019
Quote:
... (2) receptors obtained from Illumina sequencing of the transcriptome of the main olfactory epithelium ...
-
No products found
because this supplier's products are not listed.
Pei Ying Ng, et al.,
bioRxiv - Cell Biology 2022
Quote:
... IVISense Integrin Receptor (IntegriSenseTM) 645 (PerkinElmer, 1/300 dilution). Following primary antibody incubation ...
-
No products found
because this supplier's products are not listed.
Rishi Drolia, et al.,
bioRxiv - Microbiology 2023
Quote:
... that inhibits caveolae-like membrane domains or the synthetic glycosphingolipid L-t-LacCer (β-d-lactosyl-N-octanoyl-l-threo-sphingosine; 5 µM, Avanti Polar Lipids) that blocks caveolar endocytosis without some of the off-target effects of MβCD (37 ...