-
No products found
because this supplier's products are not listed.
Gözde Büyükkahraman, Tae Hoon Kim,
bioRxiv - Genomics 2023
Quote:
... Sendai Virus (Cantrell strain) obtained from Charles River was used for inducing antiviral immune response as previously indicated (Banerjee ...
-
No products found
because this supplier's products are not listed.
Kenta Tomihara, et al.,
bioRxiv - Genetics 2021
Quote:
Total RNA was isolated from the eggs at 24 hpo from a wild-type strain (p50T) and three b-4 mutant strains (e36, e37, and No. 903) using TRIzol (Invitrogen). Reverse transcription was then performed using the oligo (dT ...
-
No products found
because this supplier's products are not listed.
Li-Juan Zhang, et al.,
bioRxiv - Biochemistry 2020
Quote:
Anti-Japanese encephalitis E (mouse monoclonal, Millipore), influenza A H9N2 HA (mouse monoclonal ...
-
No products found
because this supplier's products are not listed.
Madlen Hubert, et al.,
bioRxiv - Biochemistry 2020
Quote:
pTagBFP-C (Evrogen, Moscow, RU) was used to generate the expression constructs of Rab5 and EHD2 wt or I157Q ...
-
No products found
because this supplier's products are not listed.
Carolyn Marquis, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Lysates were run on 4-15% gradient gels (BioRad), transferred (75 minutes at 100V ...
-
No products found
because this supplier's products are not listed.
Zijian Guo, et al.,
bioRxiv - Microbiology 2022
Quote:
... The RNA of rescued virus strains was extracted with QIAmp DSP viral RNA mini kit (Qiagen), reverse transcribed and amplified with OneTaq one-step RT-PCR kit (NEB ...
-
No products found
because this supplier's products are not listed.
Christoph Ruschil, et al.,
bioRxiv - Immunology 2020
Quote:
... we performed specific enzyme immunoassays to measure IgG-antibodies against tick borne encephalitis in human serum (Immunozym FSME IgG, REF 7701010, PROGEN, Heidelberg, Germany). The ELISA tests were performed according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yuria Chihara, et al.,
bioRxiv - Microbiology 2019
Quote:
... coli strain Rosetta-gami B (DE3) purchased from Merck Millipore (Merck Millipore ...
-
No products found
because this supplier's products are not listed.
Maik Wolfram-Schauerte, et al.,
bioRxiv - Microbiology 2024
Quote:
... coli B strain was dephosphorylated with 0.4 U/µL QuickCIP (NEB) in 1 x rCutSmart buffer (NEB ...
-
No products found
because this supplier's products are not listed.
Rachel D. Kelly, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Pdcd-4 (B-4, Santa Cruz, 1:1000), and Rabbit α-tubulin (ab15246 ...
-
No products found
because this supplier's products are not listed.
Mingrui Guo, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Virus transduction was performed using RetroNectin® Recombinant Human Fibronectin Fragment (Takara, cat.no. T100A/B) according to the manufacturer’s instructions (with centrifugation) ...
-
No products found
because this supplier's products are not listed.
Julya Sorokina, et al.,
bioRxiv - Microbiology 2021
Quote:
... Following QuikChange reaction (Stratagene, Moscow, Russia) with the corresponding primers (see Table S2) ...
-
No products found
because this supplier's products are not listed.
Michael L. Wallace, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Pseudotyped rabies virus (SAD B19 strain, EnvA-RbV-GFP, Addgene# 52487) was commercially obtained from the Janelia Viral Tools Facility stored at −80°C ...
-
No products found
because this supplier's products are not listed.
Anne L. Sapiro, et al.,
bioRxiv - Microbiology 2023
Quote:
... Ticks were fed on young (4–6-week-old) female C3H/HeJ mice acquired from Jackson Laboratories. Mice were anesthetized with ketamine/xylazine before placement of ≤ 100 larval or ≤ 30 nymphal ticks ...
-
No products found
because this supplier's products are not listed.
Mi Ra Chang, Patrick R. Griffin,
bioRxiv - Cell Biology 2022
Quote:
... Anti-aggrecan Ab (6-B-4, abcam) was used for primary antibody and FITC-anti mouse Ab was used for secondary antibody ...
-
No products found
because this supplier's products are not listed.
Julya Sorokina, et al.,
bioRxiv - Microbiology 2021
Quote:
... liquid chromatography media were from GE Healthcare (Moscow, Russia), reagents for agarose ...
-
No products found
because this supplier's products are not listed.
Bradley S. Jones, et al.,
bioRxiv - Microbiology 2024
Quote:
... strains were supplemented with 50 μg/mL hygromycin B (Corning, Corning, NY), 20 μg/mL kanamycin (IBI Scientific ...
-
No products found
because this supplier's products are not listed.
Tae Kwon Kim, et al.,
bioRxiv - Systems Biology 2019
Quote:
... ten ticks fully fed but not detached from the host (BD) and six ticks spontaneously detached from the host (SD) ...
-
No products found
because this supplier's products are not listed.
Drishya Kurup, et al.,
bioRxiv - Microbiology 2020
Quote:
A codon optimized MV-H gene (Edmonston B strain) was gene synthesized by GenScript. PCR amplification of the coding region of MV-H from the plasmid was performed using primers coMV-H61 N HA FWD (5’-TCGTGGTGCCAGATCTCACAGAGCCGCCATCTAT - 3’ ...
-
No products found
because this supplier's products are not listed.
Nipun Verma, et al.,
bioRxiv - Genetics 2024
Quote:
... Virus was concentrated using PEG virus precipitation (Promega # V3011). In brief ...
-
No products found
because this supplier's products are not listed.
A. A. Blisnick, et al.,
bioRxiv - Animal Behavior and Cognition 2019
Quote:
... and rps4 (a tick housekeeping gene) was evaluated by qPCR using the LightCycler 480 System (Roche). The SyBr green Master mix (Roche ...
-
No products found
because this supplier's products are not listed.
Madlen Merten, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Virus was transferred into conical tubes and spin at 20000rpm for 2 hours at 4°C in (Beckman TST2838) swinging bucket rotor ...
-
No products found
because this supplier's products are not listed.
Samantha M. Chin, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The lysate was centrifuged at 4°C (3220 g for 5 min, Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
No products found
because this supplier's products are not listed.
Alice Lepelley, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Lysate was incubated for 4 h at 4°C with anti-ECSIT2 antibody39 or IgG control (Cell Signaling, #2729), followed by overnight precipitation with 30 µL of washed Protein A sepharose 4B beads (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Mathilde Gondard, et al.,
bioRxiv - Epidemiology 2020
Quote:
... 20 µL of Proteinase K were added to 180 µL of crushed tick sample and DNA was extracted using the NucleoSpin® 96 virus Core kit (Macherey-Nagel, Germany) and the automatic platform Biomek4000 (Beckman Coulter) ...
-
No products found
because this supplier's products are not listed.
Katrine Wacenius Skov Alanin, et al.,
bioRxiv - Microbiology 2021
Quote:
... 4) DC3000 + B (Illumina only), 5 ...
-
No products found
because this supplier's products are not listed.
Yunlong Cao, et al.,
bioRxiv - Immunology 2022
Quote:
... G*ΔG-VSV virus (VSV G pseudotyped virus, Kerafast) is used to infect 293T cells (American Type Culture Collection [ATCC] ...
-
No products found
because this supplier's products are not listed.
Stefan Hinz, et al.,
bioRxiv - Cell Biology 2021
Quote:
Cells dissociated from primary HMEC strains (passage 4) were stained with anti-human CD271-PerCP/Cy5.5 (Biolegend #345122) and anti-human CD133-PE (Biolegend #372804 ...
-
No products found
because this supplier's products are not listed.
Jonathan Burnie, et al.,
bioRxiv - Microbiology 2021
Quote:
The quantification of HIV-1 p24 capsid protein was performed in captured virus lysates and virus-containing supernatants with the high-sensitivity AlphaLISA p24 detection kit following the manufacturer’s (PerkinElmer) instructions ...
-
No products found
because this supplier's products are not listed.
Chang Su, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Lysates were sonicated at 4°C using the Bioruptor Sonicator (Diagenode), with 6 cycles of 10 seconds on and 10 seconds off ...
-
No products found
because this supplier's products are not listed.
Wenqing Ma, et al.,
bioRxiv - Microbiology 2024
Quote:
... Herpes simplex virus 1 (ATCC-2011-9 strain; VR-1789) was obtained from American Type Culture Collection (ATCC).
-
No products found
because this supplier's products are not listed.
Enakshi Roy, Wen Shi, Bin Duan, St Patrick Reid,
bioRxiv - Microbiology 2020
Quote:
... Mock or virus-infected cells were fixed in 4% paraformaldehyde (PFA) (Electron Microscopy Sciences, USA) for 30 min and permeabilized with 0.1% Triton X (Fisher Bioreagents ...
-
No products found
because this supplier's products are not listed.
Alessandra M. Araujo, et al.,
bioRxiv - Immunology 2024
Quote:
... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
No products found
because this supplier's products are not listed.
S Monic, et al.,
bioRxiv - Microbiology 2022
Quote:
... total protein lysates of T.brucei BSF were separated by SDS-PAGE (4-20% Mini PROTEAN TGX stain-free precast gradient gels ...
-
No products found
because this supplier's products are not listed.
Soraia Fernandes, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The frozen specimens were later sectioned into 10 µm tick sections using a cryostat (LEICA CM1950).
-
No products found
because this supplier's products are not listed.
Linshan Sun, et al.,
bioRxiv - Neuroscience 2021
Quote:
... AAV virus was injected with a glass pipette using an infusion pump (Micro 4, WPI, USA). Viruses were injected bilaterally into target brain areas using the following coordinates ...
-
No products found
because this supplier's products are not listed.
Fatoumatta Jobe, et al.,
bioRxiv - Microbiology 2023
Quote:
... Lysates were then incubated at 4°C overnight with GFP-Trap agarose (Chromotek) or Dynabeads (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Catiule de Oliveira Santos, et al.,
bioRxiv - Immunology 2020
Quote:
... b) canine IL-4 (R&D Systems, Minneapolis, USA) at 125 ...
-
No products found
because this supplier's products are not listed.
Kai Bi, et al.,
bioRxiv - Microbiology 2020
Quote:
... The transgenic fungal strains were cultured on PDA amended with 100 μg/ml hygromycin B (Calbiochem) and/or 100 μg/ml Nourseothricin (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Carola Städele,
bioRxiv - Physiology 2023
Quote:
... Ticks were housed in 60 ml aseptic screw cap plastic vials (VWR, 216-1822P) with a mesh-covered 25 mm round hole in the lid ...
-
No products found
because this supplier's products are not listed.
Lewis Macdonald, et al.,
bioRxiv - Genetics 2022
Quote:
... whilst B-cells were cultured with 10 ng/mL IL-4 (Peprotech, 214-14) and 5 μg/mL LPS (Sigma ...
-
No products found
because this supplier's products are not listed.
Anne Marchalot, et al.,
bioRxiv - Immunology 2020
Quote:
... Sorted B cells were cultured for 4 days in RPMI 1640 with UltraGlutamine (Lonza) containing 10% FBS (Dominique Dutscher) ...
-
No products found
because this supplier's products are not listed.
Kimi Azad, et al.,
bioRxiv - Cell Biology 2022
Quote:
... coli bacterial strain (Lucigen). Expression was induced for 1h at 37°C ...
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... were purchased from Envigo (strain code: 052, Envigo). C57BL/6 ...
-
No products found
because this supplier's products are not listed.
Kelly Mitchell, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and virus was concentrated with PEG-it Virus Precipitation solution (System Biosciences). SORE6-GFP virus was added to CSCs plated on Geltrex ...
-
No products found
because this supplier's products are not listed.
Sara Expósito, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and 8-Chloro-11-(4-methyl-4-oxido-1-piperazinyl)-5H-dibenzo[b,e][1,4]diazepine (CNO) were purchased from Tocris. 8-Cyclopentyl-1,3-dimethylxanthine (CPT) ...
-
No products found
because this supplier's products are not listed.
Dipan C. Patel, et al.,
bioRxiv - Neuroscience 2023
Quote:
Primary antibodies and markers used were biotinylated WFA (4 µg/ml, B-1355-2, Vector Laboratories), guinea pig polyclonal anti-NeuN antibody (1-2 µg/ml ...
-
No products found
because this supplier's products are not listed.
William C Davis, et al.,
bioRxiv - Immunology 2019
Quote:
The three sets of primary mAb-treated mdPBMC were then incubated for 15 minutes at 4°C with anti-mouse IgG2a+b microbeads per the manufacturer’s instructions (Miltenyi Biotec). After incubation ...
-
No products found
because this supplier's products are not listed.
Sumiko Takao, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cleared lysates were incubated with 4 mL glutathione agarose resin slurry (GoldBio) for 1 h at 4° C to capture GST-KIX ...
-
No products found
because this supplier's products are not listed.
Jordan R. Barrett, et al.,
bioRxiv - Immunology 2023
Quote:
... B cells were enriched (Human Pan-B cell Enrichment Kit [19554, StemCell Technologies]) and then stained with viability dye FVS780 (565388 ...