-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... D-Luciferin Potassium Salt (>99%) was purchased from Syd Labs. LY294002 ...
-
No products found
because this supplier's products are not listed.
Toshiharu Ichinose, et al.,
bioRxiv - Neuroscience 2024
Quote:
... The ribosome-bound mRNA was eluted with 50 µl of 100 µg/ml 3× FLAG peptide (GEN-3XFLAG- 25, Protein Ark) dissolved in the lysis buffer.
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
... were incubated with or without hPF4 (20 μg/mL) and KKO (20 μg/mL) in buffer containing a final concentration of 4 μM phosphatidylcholine/phosphatidylserine (75:25, Diapharma) for 10 minutes at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
Mackenzie T. Walls, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... the overnight culture was used to inoculate 3 mL of SC media (Sunrise Science Products) with 2% (w/v ...
-
No products found
because this supplier's products are not listed.
Huiyuan Zheng, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult male and female Gcg-Cre rats from the FSU colony (N=4) were anesthetized by isoflurane inhalation (1–3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device ...
-
Recombinant Antigen
Cat# REC31620-100,
100µg USD $330.0
Ask
Malcolm Turk Hsern Tan, et al.,
bioRxiv - Microbiology 2020
Quote:
... NoV GII.4 VLPs (1.1 mg/ml, purity greater than 95%, The Native Antigen Company, UK) were pre-incubated with the fucoidan (from Fucus vesiculosus ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
No products found
because this supplier's products are not listed.
Hong Zheng, et al.,
bioRxiv - Microbiology 2021
Quote:
... the cells were labeled with 1:500 rabbit anti-CSP overnight at 4°C and 1:100 Red donkey anti-rabbit secondary antibody (Abbkine) for 1 h at room temperature ...
-
Cat# IMS206-BFR-100,
USD $59.0/100.0ml
Ask
Francesco R. Simonetti, et al.,
bioRxiv - Microbiology 2020
Quote:
... We stimulated 10-100 million PBMCs with either lysates of CMV-infected fibroblasts (Virusys,10 μg/mL) or overlapping Gag 15mer peptides (HIV-1 Gag peptide pool ...
-
No products found
because this supplier's products are not listed.
Yannick O Alexandre, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated overnight at 4°C with 10 μg/ml HSV-1 inactivated Vero cell extract (Advanced Biotechnologies). Unbound protein was washed away (PBS 0.05% Tween20 ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Wen Li, et al.,
bioRxiv - Bioengineering 2020
Quote:
... the organic phase was prepared by mixing 20 μL siRNA (4 nmol in water) with 1 mL PLGA (Durect Corporation) (5mg/mL in acetone ...
-
No products found
because this supplier's products are not listed.
Marco Locarno, et al.,
bioRxiv - Biophysics 2024
Quote:
... were obtained from Cytodiagnostics (Catalog number: GU-100-100). Notably ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Satu Lehti, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Four fractions of 500 µl (fractions 1-4) were collected after the void volume (2.7 ml) with an automated fraction collector (IZON Science, USA), combined and concentrated using ultrafiltration (Amicon Ultra ...
-
No products found
because this supplier's products are not listed.
Jihye Kim, et al.,
bioRxiv - Microbiology 2019
Quote:
... The isolated choroid plexuses were incubated in HBSS with Mg2+ and Ca2+ containing 100 µg/mL DNase I (Akron Biotechnology) for 20 min at 37 °C followed by washing in PBS twice ...
-
No products found
because this supplier's products are not listed.
Huan Peng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 4% chlorhexidine (McKesson Corporation) or 2% acetic acid (Akorn Pharmaceuticals) ...
-
No products found
because this supplier's products are not listed.
Rogan A. Grant, et al.,
bioRxiv - Immunology 2023
Quote:
... Remaining cells were then pelleted at 400g for 5 minutes at 4°C and resuspended at 1×106 cells/mL in ice-cold BamBanker medium (Bulldog Bio BB02). Cell suspensions were aliquoted at 2.5-5.0×105 cells and frozen directly at −80°C until sorting.
-
No products found
because this supplier's products are not listed.
Andrea Ridolfi, et al.,
bioRxiv - Biophysics 2023
Quote:
... the lipid films were hydrated using 4 ml of PBS and the dispersions were successively extruded using 200 nm NanoSizer MINI Liposome Extruder (T&T Scientific). The extruded liposome dispersions were further diluted with PBS to a final concentration of 0.25 mg/ml for the following experiments.
-
No products found
because this supplier's products are not listed.
Adam Sychla, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Two mL of culture was spread over LB agar plates with 100 µg/mL Ampicillin and 5% defibrinated sheep’s blood (Hardy Diagnostics SB30) and allowed to rest for 2 min ...
-
No products found
because this supplier's products are not listed.
Ruicai Long, et al.,
bioRxiv - Plant Biology 2021
Quote:
A Chinese native alfalfa cultivar Zhongmu-4 (Medicago sativa L. cv. Zhongmu-4), one of the most planted alfalfa in North China for its high yield ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Irina-Elena Lupu, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... EMCN (D. Vestweber, #VE44, 1:100) and PROX1 (Reliatech, #102-PA32, 1:100). Subsequently ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Marlys S. Fassett, et al.,
bioRxiv - Immunology 2021
Quote:
... SLIGRL (100 nmol; Peptides International), α-methyl-5-hydroxytryptamine (500 μg ...
-
No products found
because this supplier's products are not listed.
Eman A. Akam, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Tert-Butyl 3-aminopropoxycarbamate was purchased from AmBeed and used without further purification ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Fumiyuki Hatanaka, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 1:100 (MCA-1B7, EnCor Biotechnology); anti-ChAT ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Qinghong Xue, et al.,
bioRxiv - Immunology 2019
Quote:
... and goat IgG (i.e., three positive control points) were printed in 4×4 array by non-contact spotter sciFLEXARRAYER S1 (Scienion, Berlin, Germany) (Fig 2d) ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Jiyeon Leem, Jae-Sung Kim, Jeong Su Oh,
bioRxiv - Cell Biology 2022
Quote:
... anti-centromere (1:100, 15-234, Antibodies Incorporated), anti-CIP2A (1:500 ...
-
No products found
because this supplier's products are not listed.
Sachiko Haga-Yamanaka, et al.,
bioRxiv - Neuroscience 2023
Quote:
... HDAC 4 (50064 and 50076, BPS Bioscience, San Diego, CA), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Priscille Riondel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... using the vertical PC-100 puller (Narishige International Ltd) and filled with an internal solution supplemented with 10 μM of the fluorescent dye AlexaFluor 594 (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Ameya P. Jalihal, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and imaged on a Bioptechs temperature control module (Bioptechs, 0420-4). High-throughput IF was performed on the same microscope using a 60x 0.9 NA air objective ...
-
No products found
because this supplier's products are not listed.
Cerys S Manning, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Western blots were performed using 4-20% Tris-glycine acrylamide gels (NuSep), Whatman Protran nitrocellulose membrane (Sigma ...
-
No products found
because this supplier's products are not listed.
Dario Campagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The brain was sectioned coronally (100 μm) with a vibrotome (Campden Instruments) in ice-cold PBS (0.1 M) ...
-
No products found
because this supplier's products are not listed.
Vipul T. Vachharajani, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3-5 mm wide slits were cut with a razor blade into a piece of Parafilm M (Bemis) and sandwiched between a glass slide (1 mm thick ...
-
No products found
because this supplier's products are not listed.
Mira N. Moufarrej, Stephen R. Quake,
bioRxiv - Bioengineering 2022
Quote:
1.2 mL pipette tips (Rainin, cat. no. 30389231)
-
No products found
because this supplier's products are not listed.
Malgorzata Zawadzka, et al.,
bioRxiv - Biochemistry 2020
Quote:
... in 1.5 mL vials (Thumbs up microtubes, Diversified Biotech, Boston, MA, US), with medium or no heating ...
-
No products found
because this supplier's products are not listed.
Olivia E. Harwood, et al.,
bioRxiv - Immunology 2023
Quote:
... were coated with 0.5 μg/mL SIVmac239 gp120 (Immune Technology, New York, NY) in coating buffer (2.25mg/mL Na2CO3 and 4.395mg/mL NaHCO3 in distilled H2O) ...
-
No products found
because this supplier's products are not listed.
Sylvia Mutinda, et al.,
bioRxiv - Plant Biology 2022
Quote:
... the seeds were pre-germinated by adding 3 ml of 0.1 ppm GR24 (Chiralix, Nijmegen, Netherlands) and incubating overnight at 30 °C.
-
No products found
because this supplier's products are not listed.
Xiaodan Zhang, et al.,
bioRxiv - Genomics 2021
Quote:
... anti-mouse Lyve1 antibody (1:100, AngioBio cat.no ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Esther W. Lim, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 400 µL saline and 100 µL of water spiked with deuterated internal standards (100 picomoles of D7-sphingosine (Avanti, Croda International Plc, 860657), 20 picomoles of D7-sphinganine (Avanti ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
... depleted plasma was supplemented with purified FXI (100 pM; Haematologic Technologies) or FXII (1.2 nM ...
-
No products found
because this supplier's products are not listed.
Susan D’Costa, Matthew J. Rich, Brian O. Diekman,
bioRxiv - Bioengineering 2019
Quote:
... with TRIzol™ and homogenized at 6500 rpm × 30 seconds for 3 cycles (Precellys® 24, Bertin Corp). Protein concentration was determined using the Micro BCA Protein assay kit (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Yuanchen Yu, et al.,
bioRxiv - Microbiology 2020
Quote:
... The channel array was maintained at 37 °C with a TC-1-100s temperature controller (Bioscience Tools). For all direct comparisons ...