-
No products found
because this supplier's products are not listed.
Nazish Sayed, et al.,
bioRxiv - Immunology 2019
Quote:
... The cells were resuspended in 100 uL PBS buffer containing 2 ug/mL Live-Dead (DOTA-maleimide (Macrocyclics) containing natural-abundance indium) ...
-
No products found
because this supplier's products are not listed.
Derek C. K. Chan, Lori L. Burrows,
bioRxiv - Microbiology 2020
Quote:
... Deferasirox was purchased from AK Scientific (98% purity). A stock solution of 20 mg/mL in DMSO was made ...
-
No products found
because this supplier's products are not listed.
A Hendriks, et al.,
bioRxiv - Microbiology 2020
Quote:
... MUTZ-3 cells were differentiated in the presence of 100 ng/ml GM-CSF (Genway Biotech), 10 ng/ml TGF-β (R&D systems ...
-
No products found
because this supplier's products are not listed.
Patrick Slaine, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 100 U/mL penicillin + 100 μg/mL streptomycin + 20 μg/mL-glutamine (Pen/Strep/Gln; Wisent Bioproducts, St-Bruno, QC, Canada) at 37°C in 5% CO2 atmosphere ...
-
No products found
because this supplier's products are not listed.
Ragna S. Häussler, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Activation buffer consisting of 10 mg/ml 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (C1100, ProteoChem) and 10 mg/ml Sulfo-N-hydroxysulfosuccinimide (Sulfo-NHS ...
-
Cat# 3129-43-9,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
Testosterone ELISA / assay Kit
Cat# K032-H5W,
1.0 ea, USD $995.0
Ask
Lisa Mohr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 4°C for 10 min and 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Avanti Gokhale, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3 1-minute washes) on a mini-100 orbital genie (Scientific Industries) at room temperature ...
-
No products found
because this supplier's products are not listed.
Ibrar Siddique, et al.,
bioRxiv - Cell Biology 2021
Quote:
... supplemented with 10% fetal bovine serum (FBS) and a penicillin-streptomycin solution (100 units/mL of penicillin and 100 μg/mL of streptomycin, Caisson labs, PSL01). SH-SY5Y cells were plated at 30,000 cells per well in 8-chamber slides and grown to 60% confluency.
-
No products found
because this supplier's products are not listed.
Joseph H. Garcia, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... was used to functionalize sodium hyaluronate (Lifecore Biomedical, Research Grade, 66 kDa – 99 kDa) with methacrylate groups (Me-HA) ...
-
No products found
because this supplier's products are not listed.
Nai-Wen Chi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and GCK (rabbit polyclonal, Aviva Inc. Cat. OAAF05763, 3 μg/ml). Similar staining patterns were observed (not shown ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
A.J. Middleton, et al.,
bioRxiv - Biochemistry 2021
Quote:
... at 200:200 nL and 200:100 nL protein:well solution drop ratios in Swissci 3-well sitting drop plates using a mosquito (TTP Labtech). Diffraction-quality crystals of the UbV.k.2-Ube2k complex were produced in 0.2 M sodium citrate tribasic trihydrate ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Neuroscience 2021
Quote:
RNA was extracted from mouse brain lysates (mixture of 3∼4 mouse brains for each sample) using RNAprep pure Tissue Kit (Tiangen, DP431). cDNA was synthesized using HiScript II 1st Strand cDNA Synthesis Kit (Vazyme ...
-
No products found
because this supplier's products are not listed.
Marcin Poreba, et al.,
bioRxiv - Biochemistry 2019
Quote:
... N,N-diisopropylethylamine (DIPEA, peptide grade), piperidine (PIP, peptide grade), and trifluoroacetic acid (TFA, purity 99%) were all from Iris Biotech. 2,4,6-trimethylpyridine (2,4,6-collidine ...
-
No products found
because this supplier's products are not listed.
Alexander I. Kostyuk, et al.,
bioRxiv - Immunology 2021
Quote:
... the corresponding gene was amplified with the use of the №17/№34 primer pair and purified with Cleanup Standard Kit (Evrogen). The obtained construct and intact PCS2+ vector were incubated with ClaI and XbaI FastDigest™ enzymes in the corresponding buffer (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Luned M. Badder, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... genomic DNA was extracted from 4 ml of whole blood using the ChemagicSTAR automated cell lysis and DNA extraction workstation (Hamilton Company) housed within the All Wales Medical Genetics Service (AWMGS ...
-
No products found
because this supplier's products are not listed.
Debapriya Chakraborty, et al.,
bioRxiv - Cell Biology 2019
Quote:
... LC3B (Nanotools, 0260-100), LC3B (Sigma ...
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...
-
No products found
because this supplier's products are not listed.
Stefanos Giannakopoulos, et al.,
bioRxiv - Microbiology 2023
Quote:
... Mouse Testosterone ELISA Kit (Crystal Chem. Cat. # 80552), Mouse FSH ELISA Kit (Abclonal Cat ...
-
No products found
because this supplier's products are not listed.
Charles H. Danan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Total blotted mRNA was stained using 0.04% Methylene Blue (LabChem LC168508) in 0.5M sodium acetate.
-
No products found
because this supplier's products are not listed.
Jasvinder S. Ahuja, et al.,
bioRxiv - Genetics 2021
Quote:
... cells were pelleted and resuspended in 4 mL YPD broth containing 100 µg/mL nourseothricin sulfate (Neta Scientific) and aerated at 30°C for 12 h ...
-
No products found
because this supplier's products are not listed.
José Leal, et al.,
bioRxiv - Biophysics 2023
Quote:
... a silver/silver-chloride (Ag/AgCl, BASI, USA) electrode as the reference (RE) ...
-
No products found
because this supplier's products are not listed.
Ina J. Andresen, et al.,
bioRxiv - Cell Biology 2020
Quote:
... RNA from 3 batches (batch 17, 19 and 25) was isolated using the “Single Cell RNA Purification Kit” (NORGEN BIOTEK CORP, Canada) with an 8 ul elution buffer ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... 100 mg/mL PEG5000-silane (Nanocs) dissolved in 95% ethanol] was sandwiched by two coverslips and incubated at room temperature for 2 hr inside a sealed wet chamber ...
-
No products found
because this supplier's products are not listed.
Leanna M. Owen, et al.,
bioRxiv - Biophysics 2020
Quote:
BSA (1 mg/mL, MCLAB UBSA-100) diluted in FB7.1 was incubated in the chamber for 5 minutes.
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Shota Yoshida, et al.,
bioRxiv - Immunology 2020
Quote:
... The synthetic peptide was purified by reverse-phase HPLC (>98% purity) (Peptide Institute Inc., Osaka, Japan.). The synthetic SARS-CoV-2 peptide was reconstituted at 5 mg/ml in sterile PBS and stored below −20°C.
-
No products found
because this supplier's products are not listed.
Olga Ponomarchuk, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and cultured in CnT-17 medium (CellnTec Advanced Cell Systems, Bern, CH) until 80% confluence was reached ...
-
No products found
because this supplier's products are not listed.
Yilin Yang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Cdh5-CreERT2 mice (3 Kate2 vs. 4 HDAC6) were fed with a control liquid diet (F1259SP, Bio-Serv) for 10 days and were sacrificed for sample collection ...
-
No products found
because this supplier's products are not listed.
Julia I. Ries, et al.,
bioRxiv - Microbiology 2022
Quote:
... lipopolysaccharide from Salmonella enteridis (100 ng/ml) (Hycult Biotech Uden, The Netherlands) for the AP or mannan (1 µg/ml ...
-
No products found
because this supplier's products are not listed.
Stefanie K. Menzies, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... typus venom (Product code L1403, origin South Africa, purity >99%) was sourced from Latoxan (Portes les Valence, France) and stored at 4 °C to ensure long-term stability ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Unsorted Lin− cells or sorted HSCs were cultured in a retronectin-coated 6 cm2 dish with 3 mL viral supernatants for 6 h in 3 mL IMDM media supplemented with 15% heat inactivated fetal bovine serum (Atlanta Biologicals), 1% bovine serum albumin (Gemini bio-products) ...
-
No products found
because this supplier's products are not listed.
Asta Lučiūnaitė, et al.,
bioRxiv - Immunology 2021
Quote:
... and FAM-FLICA® Caspase-1 Assay Kit (containing FLICA reagent FAM-YVAD-FMK – caspase-1 inhibitor probe; cat#98) were obtained from ImmunoChemistry Technologies. Dimethylsulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Hyeree Park, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Aliquots of 1 mL of each solution was cast in a 4 mL Wheaton Omni-Vial® (DWK Life Sciences, USA). Human ACL fibroblast-osteoblast seeded ADCs were cultured for 14 days tethered ...
-
No products found
because this supplier's products are not listed.
Lukas-Adrian Gurzeler, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... the cells were treated with 100 μg/ml Cycloheximide (Focus Biomolecules, Cat# 10-117) and incubated for 4 min to stop translation and stabilize ribosomes on the mRNAs ...
-
No products found
because this supplier's products are not listed.
Hanyu Pan, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Yang.17 The PD-1 blocking scFv E27 gene was synthesized by GENEWIZ (GENEWIZ, Suzhou, China) according to the previous report.36 3BNC117 CAR and E27 were cloned into a lentiviral vector (pTRPE-GFP-T2A-mRFP ...
-
No products found
because this supplier's products are not listed.
Sonali Singh, et al.,
bioRxiv - Microbiology 2020
Quote:
... After washing three times with PBS blocking was carried out by adding 50 µl of 3% (w/v) bovine serum albumin (BSA) (80400-100, Alpha diagnostics) prepared in PBS ...
-
No products found
because this supplier's products are not listed.
Yu-An Kuo, et al.,
bioRxiv - Bioengineering 2021
Quote:
We quantified NCB fluorescence using a fluorometer (FluoroMax-4, Horiba) and a 100 µl quartz cuvette (16.100F-Q-10/Z15, Starna Cells). Both the excitation and emission wavelength scan ranges were set to be from 400 nm to 800 nm using 5 nm slit size ...
-
No products found
because this supplier's products are not listed.
Rene Yu-Hong Cheng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 3 mL syringes (Becton Dickinson) were connected to the bead and sample inlet reservoirs via PEEK tubing (IDEX) and a coupler molded out of PDMS ...
-
No products found
because this supplier's products are not listed.
NG Tolman, et al.,
bioRxiv - Genetics 2020
Quote:
... mice were acclimatized to the procedure room and anesthetized via an intraperitoneal injection of a mixture of ketamine (99 mg/kg; Ketlar, Parke-Davis, Paramus, NJ) and xylazine (9 mg/kg; Rompun, Phoenix Pharmaceutical, St. Joseph, MO) immediately prior to IOP assessment ...
-
No products found
because this supplier's products are not listed.
Takafumi Kato, et al.,
bioRxiv - Pathology 2021
Quote:
... PRR4 cDNA without a signal peptide sequence (corresponding to amino acids 17 to 134) was cloned into the pM-secSUMOstar Vector (7121, LifeSensors). SUMOstar-PRR4 vectors were transfected into Expi293 cells (1 mg of DNA per liter of transfection ...
-
No products found
because this supplier's products are not listed.
FREDERICO VIEIRA, Johannes W Kung, Faizah Bhatti,
bioRxiv - Immunology 2020
Quote:
... Sections were then incubated in the following primary antibodies overnight at 4 °C: rabbit polyclonal anti-SP-D (1:100 dilution; Antibodies-online Inc., St. Atlanta, GA, USA); rat anti-CD31 for endothelial cells (1:200 dilution ...
-
No products found
because this supplier's products are not listed.
Carolaing Gabaldon, et al.,
bioRxiv - Microbiology 2020
Quote:
... The pellet of synchronized worms (L2) was treated with 4 mm steel beads and 1 mL of RNA-Solv® Reagent (Omega Bio-Tek). The mix was vortexed for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Nereus W. Gunther IV, et al.,
bioRxiv - Microbiology 2022
Quote:
... ProteaPrep cell lysis buffer plus 100 μLs of a protease inhibitor cocktail was used to suspend each of the cell pellets before placing them in 2 mL micro-centrifuge tubes preloaded with low protein binding 100 micron zirconium beads (OPS Diagnostics, LLC, Lebanon, NJ). Next the cells were disrupted by agitation of the beads using a BeadBeater system (BioSpec Products ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Baruch Haimson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and rabbit anti 5HT 1:100 (Immunostar). The following secondary antibodies were used ...
-
No products found
because this supplier's products are not listed.
Sarah Moyon, et al.,
bioRxiv - Neuroscience 2020
Quote:
... rabbit anti-TET2 (Epigentek, A-1701, 1:100), rabbit anti-TET3 (Abcam ...
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...