-
No products found
because this supplier's products are not listed.
Jaebin Kim, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
... and 5 µM cytosine arabinoside (Sigma) was also added to suppress glial proliferation ...
-
No products found
because this supplier's products are not listed.
Colin P Sharp, et al.,
bioRxiv - Microbiology 2023
Quote:
... Transcend Biotin-Lysyl-tRNA (Promega) was incorporated in reactions so that reaction products could be identified using western blotting as above ...
-
No products found
because this supplier's products are not listed.
Ferda Topal Celikkan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... or DNMT3A (DNA cytosine-5-methyltransferase 3A protein) (1:200 in PBS) (Abcam; ab23565, USA) at 4°C o/n ...
-
No products found
because this supplier's products are not listed.
Leiping Zeng, Lei S. Qi,
bioRxiv - Bioengineering 2024
Quote:
... and methyltransferase (NEB# M0366S) by following the vendor’s manuscripts.
-
No products found
because this supplier's products are not listed.
Krishma H Ramgoolam, Annette C Dolphin,
bioRxiv - Neuroscience 2022
Quote:
... 5 μM cytosine-A-D-arabinofuranoside (AraC; Gibco) was added to cultures for 12 h ...
-
No products found
because this supplier's products are not listed.
Nusrat Shahin Qureshi, Olivier Duss,
bioRxiv - Biophysics 2023
Quote:
... Elongator tRNAs were purchased (tRNA MRE600, Roche) and charged typically at 500 μM concentration in presence of 0.2 mM amino acid mix (each) ...
-
No products found
because this supplier's products are not listed.
Jhon R. Enterina, et al.,
bioRxiv - Immunology 2021
Quote:
... and antibodies GL7-biotin (BioLegend), anti-mouse IgD (clone ...
-
No products found
because this supplier's products are not listed.
Máté Kiss, et al.,
bioRxiv - Immunology 2020
Quote:
... or biotin-labeled antibodies (Jackson Immunoresearch) were applied ...
-
No products found
because this supplier's products are not listed.
Aleksey Chudnovskiy, et al.,
bioRxiv - Immunology 2022
Quote:
... an anti-biotin–PE antibody (Miltenyi Biotec) was exclusively used as described 26 ...
-
No products found
because this supplier's products are not listed.
Christina M. Bebber, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... unspecific bindings (5% BSA, 5% NGS in PBST, 1h) and Avidin/Biotin (Avidin/Biotin Blocking Kit, Vector Laboratories, SP-2001, 15 min). Samples were incubated overnight at 4°C with anti-MDA antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Y Kharel, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... 5 µL Biotin Rat Anti-Mouse TER119 and 5 µL Biotin Rat Anti-Mouse CD45R (BD Biosciences, Franklin Lakes, NJ) were added into the sample ...
-
No products found
because this supplier's products are not listed.
Nimra Khan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... The pDB070.iodo.5 plasmid containing the modified tRNA and tRNA synthetase for p-iodo-L-phenylalanine incorporation was obtained from Addgene (#99397) as a gift from David Liu [31] ...
-
No products found
because this supplier's products are not listed.
Bin Jia, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... Restriction fragment ends were labeled with biotinylated cytosine nucleotides by biotin-14-dCTP (TriLINK). Blunt-end ligation was carried out at 16 °C overnight in the presence of 100 Weiss units of T4 DNA ligase (Thermo ...
-
No products found
because this supplier's products are not listed.
Friederike Leesch, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 0.1 mg/mL tRNAs (Merck), 40 μg/mL creatine kinase ...
-
No products found
because this supplier's products are not listed.
Elisa Vilardo, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The pre-tRNAs were 3’ biotinylated with pCp-biotin (750 µM; Jena Bioscience) and T4 RNA ligase (2 units/µl) ...
-
No products found
because this supplier's products are not listed.
Katharina Gapp, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
No products found
because this supplier's products are not listed.
Lucia Bossoni, et al.,
bioRxiv - Biophysics 2021
Quote:
... with second antibody Rb-aMs/biotin (DAKO) for 1h at room temperature ...
-
No products found
because this supplier's products are not listed.
Ulrike Schumann, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-TRDMT1 (1:1,000; Proteintech 19221-1-AP), anti-tubulin (1:1,000 ...
-
No products found
because this supplier's products are not listed.
Basudev Ghoshal, et al.,
bioRxiv - Plant Biology 2020
Quote:
... tRNA-guide4-tRNA and tRNA-guide4-tRNA-guide10-tRNA-guide18 sequences were synthesized by GenScript and were inserted at the HpaI and SmaI site by directional cloning.
-
No products found
because this supplier's products are not listed.
Chuyu Fang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5% biotin-labeled tubulin (Cytoskeleton, T333P), and 90% unlabeled tubulin (Cytoskeleton ...
-
No products found
because this supplier's products are not listed.
Filippo Macchi, Eric Edsinger, Kirsten C. Sadler,
bioRxiv - Genomics 2022
Quote:
... or anti-5-methyl-cytosine (5mC – Aviva Biosystem clone 33D3 ...
-
No products found
because this supplier's products are not listed.
Divya Reddy, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 2µg of antibody (Methyl cytosine: Diagenode MAb-006-100 ...
-
No products found
because this supplier's products are not listed.
Baylea Davenport, et al.,
bioRxiv - Physiology 2022
Quote:
... an anti-biotin antibody (Cell Signaling) was also applied to visualize the biotinylated protein ladder ...
-
No products found
because this supplier's products are not listed.
Raiha Tahir, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Anti-biotin antibody (Bethyl Laboratories, #150-109A), streptavidin-HRP (Abcam ...
-
No products found
because this supplier's products are not listed.
Uli Schmitz, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
Histone methyltransferase assays were performed in 96-well half-area optiplates (PerkinElmer) at room temperature ...
-
No products found
because this supplier's products are not listed.
Lu Hu, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 100 uM Biotin-Azide (1167-5, Click Chemistry Tools) and incubated for another 1 h ...
-
No products found
because this supplier's products are not listed.
Gayan I. Balasooriya, David L. Spector,
bioRxiv - Cell Biology 2023
Quote:
... Biotin antibody (33) 1: 1000 (Santa Cruz, Cat.No. 101339), LaminB1 (1:500 ...
-
No products found
because this supplier's products are not listed.
Mary Kay Thompson, et al.,
bioRxiv - Biochemistry 2022
Quote:
... MTSEA biotin-XX (MTS-biotin, Biotium #90066) was added to a final concentration of 0.04 mg/ml as suggested35 ...
-
No products found
because this supplier's products are not listed.
Haley N. Bridge, Clara L. Frazier, Amy M. Weeks,
bioRxiv - Biochemistry 2023
Quote:
... Biotin azide (5) was purchased from Cayman Chemical. Azide-SS-biotin (6 ...
-
No products found
because this supplier's products are not listed.
Eric D. Hoffer, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the 5’ half of the tRNA (nucleotides 1-39) was chemically synthesized (GE Healthcare Dharmacon) and enzymatically ligated to the chemically synthesized 3’ half following established protocols (52 ...
-
No products found
because this supplier's products are not listed.
Mayank Verma, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... biotin-conjugated anti-PlGF2 antibody (BAF465, R&D Systems) was added followed by a Streptavidin-HRP (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Gali Maor, Ronald R. Dubreuil, Mel B. Feany,
bioRxiv - Neuroscience 2023
Quote:
... biotin-conjugated secondary antibodies (1:200, SouthernBiotech) and avidin-biotin-peroxidase complex (Vectastain Elite ...
-
No products found
because this supplier's products are not listed.
Rohit Singh Rawat, et al.,
bioRxiv - Neuroscience 2022
Quote:
... isolated from hypothalamus and PFC of F0 and F1 male mice was diluted in immunoprecipitation buffer and incubated with 2 μg 5-methyl cytosine antibody (A-1014; Epigentek) at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Cédric Gobet, et al.,
bioRxiv - Systems Biology 2019
Quote:
... Biotinylated tRNAs were cleaned using RNA Clean & Concentrator -5 kit (Zymo) according to manufacturer’s instructions and eluted in 20 µl H20.
-
No products found
because this supplier's products are not listed.
Autumn R Tobin, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 10 μL of 5 mM D-biotin (Avidity) were added to the protein along with BirA ligase ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
Biotin-labeled (BT) monkey IgA antibody (Mabtech, Sweden), BT monkey IgA(alpha-chain ...
-
No products found
because this supplier's products are not listed.
Yu-Han Hung, et al.,
bioRxiv - Genomics 2021
Quote:
... 100 ng yeast tRNA (VWR, 80054–306), 0.8 units/μL SUPERase In RNase Inhibitor ...
-
No products found
because this supplier's products are not listed.
Stephen D. Carter, et al.,
bioRxiv - Cell Biology 2021
Quote:
... followed by rabbit anti-biotin antibody (Rockland, 100-4198) at 1:10000 ...
-
No products found
because this supplier's products are not listed.
Dingyuan Guo, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The tRNA was transferred onto nylon membrane by TRANS-Blot SD (Cat#170-3940, Bio-Rad, USA) at 650 mA for 30 min and the membrane was washed briefly in 5 × SSC (0.75 M sodium chloride ...
-
No products found
because this supplier's products are not listed.
Kangkang Niu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Unmethylated cytosines were converted into uracil by using a MethylDetector kit (55001, Active Motif, CA, USA), whereas methylated cytosines remained unchanged ...
-
No products found
because this supplier's products are not listed.
Shuo Han, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Biotin phenol (Iris Biotech) was dissolved in DMSO as 500 mM stock solution and added directly to cell culture media to a final concentration of 500 μM ...
-
No products found
because this supplier's products are not listed.
Araceli Perez-Lopez, et al.,
bioRxiv - Immunology 2022
Quote:
... human anti-myeloperoxidase (MPO)-Biotin antibody (clone MPO421-8B2, Novus Biologicals), and APC/Cy7 streptavidin (BioLegend) ...
-
No products found
because this supplier's products are not listed.
Glenn F. W. Walpole, et al.,
bioRxiv - Cell Biology 2021
Quote:
PLL(20)-g[3.5]-PEG(5) and PLL(20)-g[3.5]-PEG(2)/PEG(3.4)-biotin(20%) (Susos Surface Technology) were suspended in 150 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Jesslyn E. Park, et al.,
bioRxiv - Molecular Biology 2023
Quote:
tRNA-Tyr and tRNA-Val probes were labeled with IRDye800RD and the tRNA-Gly probe was labeled with IRDye680RD (LI-COR), respectively ...
-
No products found
because this supplier's products are not listed.
John E G Lawrence, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and Opal 650 and TSA-biotin (TSA Plus Biotin Kit) (Akoya Biosciences) and streptavidin-conjugated Atto 425 (Sigma ...
-
No products found
because this supplier's products are not listed.
Fernando Y. Maeda, et al.,
bioRxiv - Cell Biology 2021
Quote:
... liposomes were generated from 5 mM 1,2-dioleoyl-sn-glycero-3-phosphocholine plus 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-cap-biotin (Avanti Polar Lipids) at a 100:1 molar ratio by sonication ...
-
No products found
because this supplier's products are not listed.
Souradeep Basu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... EPIgenous Methyltransferase kit (Cisbio Bioassays) was used for the detection of methyltransferase activity as with nsp14.
-
No products found
because this supplier's products are not listed.
Rachel Newcomb, Emily Dean, James V. Alvarez,
bioRxiv - Cancer Biology 2021
Quote:
... and a biotin conjugated anti Mouse CD45 antibody (Stem Cell Technologies, Catalog #60030BT) according to the manufacturers protocol.
-
No products found
because this supplier's products are not listed.
Kristen L. Wells, et al.,
bioRxiv - Immunology 2020
Quote:
... Anti-RANKL antibody (Clone IK22/5, BioXCell) or isotype control antibody (clone 2A3 ...
-
No products found
because this supplier's products are not listed.
Philippe C Després, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... Cytosine and 5-FC were purchased from Alfa Aesar (now Thermo Scientific Chemicals ...