-
No products found
because this supplier's products are not listed.
Xiucui Ma, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse TNF-alpha (R&D Systems, MTA00B), mouse IL-6 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Stephanie J. Melchor, et al.,
bioRxiv - Immunology 2019
Quote:
... Mouse TNF alpha Uncoated ELISA (Invitrogen, #88-7324); IL-1 alpha Mouse Uncoated ELISA Kit (ThermoFisher #88-501988) ...
-
No products found
because this supplier's products are not listed.
Christopher P Saxby, et al.,
bioRxiv - Bioengineering 2023
Quote:
... TNF-alpha (BD, Cat. # 563996), IL-2 (BioLegend ...
-
No products found
because this supplier's products are not listed.
Ewa Bielczyk-Maczynska, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Recombinant human TNF-alpha (PeproTech/VWR) was used at a concentration of 10 ng/ml.
-
No products found
because this supplier's products are not listed.
Phillip M Mackie, et al.,
bioRxiv - Neuroscience 2021
Quote:
... TNF-alpha (Biolegend, 502908, PE, 1:100), IL1beta (Biolegend ...
-
No products found
because this supplier's products are not listed.
Lana Frankle, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and TNF alpha (rabbit host, abcam). Blots were then washed in Tris-buffered saline with Tween-20 (TBST ...
-
No products found
because this supplier's products are not listed.
Nikita P. Patil, et al.,
bioRxiv - Physiology 2022
Quote:
... Tumor necrosis factor alpha (TNF-α, 20 ng/mL; Sigma-Aldrich) and cycloheximide (chx ...
-
No products found
because this supplier's products are not listed.
Nontawat Chuinsiri, et al.,
bioRxiv - Physiology 2023
Quote:
... TNF-alpha (Merck); mouse monoclonal anti-CaSR (ab19347 ...
-
No products found
because this supplier's products are not listed.
Gavin D. Lagani, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mouse anti-p70 S6 kinase alpha (Santa Cruz Biotechnology Cat# sc-8418 ...
-
No products found
because this supplier's products are not listed.
Han-Ming Wu, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... TNF Alpha Polyclonal Antibody (Proteintech, 17590-1-AP), and GAPDH antibody (Proteintech ...
-
No products found
because this supplier's products are not listed.
Masae Heront-Kishi, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... with or without the addition of the cytokines TNF-alpha (20 ng/mL, Cell Signaling Technology) and TGF-beta 1 (10 ng/mL ...
-
No products found
because this supplier's products are not listed.
Livnat Jerby-Arnon, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... TNF-alpha (Miltenyi Biotec, Human TNF-α, Cat. No. 130-094-014) IFN-gamma (R&D systems ...
-
No products found
because this supplier's products are not listed.
Ryosuke Hiwa, et al.,
bioRxiv - Immunology 2021
Quote:
... Mouse anti-dsDNA IgG-specific ELISA Kit was from Alpha diagnostic. Mouse IL-2 DuoSet ELISA DuoSet and Ancillary Reagent Kit 2 were from R&D Systems.
-
No products found
because this supplier's products are not listed.
D. Azimova, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse anti-alpha-tubulin (Novus biological DM1A), Rabbit anti-calnexin (abcam 22595) ...
-
No products found
because this supplier's products are not listed.
Leopoldo F. M. Machado, Andrew Currin, Neil Dixon,
bioRxiv - Bioengineering 2019
Quote:
... coli DH5-alpha (NEB), transformation for induction test was made into E ...
-
No products found
because this supplier's products are not listed.
Musleh M. Muthana, et al.,
bioRxiv - Immunology 2023
Quote:
... Mouse TNF-alpha (Sino Biological Inc, 50349-MNAE). IgE ELISA Kit (Thermo Fisher Scientific/Invitrogen ...
-
No products found
because this supplier's products are not listed.
Peter F. Renz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Full length murine Tnf was PCR amplified from GFP-TNF-alpha plasmid (Addgene #28089) via Phusion PCR according to manufacturer’s protocol with the following primer ...
-
No products found
because this supplier's products are not listed.
Cristina M. Failla, et al.,
bioRxiv - Cell Biology 2019
Quote:
... TNF-α) (BioRad). Data were analyzed using Bio-Plex Software Manager 6.1 ...
-
No products found
because this supplier's products are not listed.
Sofia Nasif, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... TNFα treatment (25 ng/ml rh TNF-alpha, STEMCELL Technologies) was performed in DMEM without FCS for 20 hours ...
-
No products found
because this supplier's products are not listed.
Juan Ji An, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and alpha-35S-UTP (PerkinElmer #NEG039H250UC). Brain sections were postfixed in 4% paraformaldehyde for 1 h and acetylated for 10 min with 0.1M triethanolamine hydrochloride/0.25% acetic anhydride (pH 8.0) ...
-
No products found
because this supplier's products are not listed.
Carlos Gomez-Diaz, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse TNF (Immunotools, 12343017), cycloheximide (CHX ...
-
No products found
because this supplier's products are not listed.
Marco Tigano, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... TNF-alpha (200 ng ml−1, Invivogen), IFN-beta (5 ng ml−1 ...
-
No products found
because this supplier's products are not listed.
Florian Gaertner, et al.,
bioRxiv - Immunology 2022
Quote:
... Interferon alpha was measured by ELISA (Mouse IFN Alpha All Subtype ELISA Kit, High Sensitivity, PBL Assay Science). Blood was left at room temperature for 20 min and after centrifugation serum was frozen at -20°C until further analysis ...
-
No products found
because this supplier's products are not listed.
Santoshi Muppala, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... monoclonal mouse anti-human alpha smooth muscle actin (M0851, Dako), monoclonal mouse anti-human CD68 (M0814 ...
-
No products found
because this supplier's products are not listed.
Nikhil Pandey, Priyanka Mishra,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... digital vernacular calliper(Mavotank Pvt ltd),For biochemical procedure-Mouse TNF alpha ELISA kit was purchased from Elabscience (E-EL-M3063), TRIzol (Ambion),TURBO DNA-free Kit (Invitrogen),RevertAid First Strand cDNA Synthesis kit (Thermo scientific).
-
No products found
because this supplier's products are not listed.
Ewa Bielczyk-Maczynska, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Recombinant human TNF-alpha (PeproTech/VWR) was used at a concentration of 10 ng/ml.
-
No products found
because this supplier's products are not listed.
Salomé Adam, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... mouse anti-alpha-tubulin (Calbiochem CP06, 1:2000 IB), rat anti-HA (Roche 11867423001 ...
-
No products found
because this supplier's products are not listed.
Alexandra Thiran, et al.,
bioRxiv - Immunology 2023
Quote:
... and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT; tnf rev TCAAAATTCGAGTGACAAGCCTG) were used on LightCycler 480 (Roche). The reactions were performed in triplicates and the results were analyzed with qbase+ software ...
-
No products found
because this supplier's products are not listed.
Hae Ryong Kwon, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... in alpha MEM (Corning) plus 10% FBS (mesenchymal stem cell-qualified ...
-
No products found
because this supplier's products are not listed.
I. Deniz Derman, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Alpha Tubulin (TUBA4A) mouse monoclonal antibody (Origene) and MUC5AC monoclonal antibody (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Hidehiko Okuma, et al.,
bioRxiv - Biochemistry 2022
Quote:
... The sequence encoding mouse alpha-DG N terminal domain(a-DGN) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
No products found
because this supplier's products are not listed.
Sarah M. Ryan, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... and rabbit anti-alpha tubulin (1:5000) and either goat anti-mouse HRP 1:20,000 (Jackson Labs) or goat anti-rabbit HRP 1:40,000 (Jackson Labs) ...
-
No products found
because this supplier's products are not listed.
Kunal M. Shah, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... mouse anti-alpha-Tubulin (GeneTex, GTX628802) and mouse anti-Histone H3 (Upstate ...
-
No products found
because this supplier's products are not listed.
Hao Gu, et al.,
bioRxiv - Immunology 2021
Quote:
... mice were treated with 200 μg anti-mouse TNF-α (XT3.11 clone, BioXcell, West Lebanon, NH) or rat IgG1 isotype antibody intraperitoneally 1 h before infection ...
-
No products found
because this supplier's products are not listed.
Roberto R. Moraes Barros, et al.,
bioRxiv - Microbiology 2021
Quote:
... knowlesi elongation factor-1 alpha (pkef1-alpha) 5’ UTR were isolated from agarose gels and cloned into the pGEM-T vector (Promega, Madison, WI, USA). To replace the pfcam 5’ UTR sequence that drives luciferase transcription in the pD-pfcam-Luc ...
-
No products found
because this supplier's products are not listed.
Patricia Mendonca, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and tumor necrosis factor alpha (TNF-α) were purchased from RayBiotech (Norcross, Ga, USA). PCR primers and iScript advanced reverse transcriptase kit were purchased from Bio-Rad (Hercules ...
-
No products found
because this supplier's products are not listed.
Janin Knop, et al.,
bioRxiv - Immunology 2019
Quote:
... multimeric TNF (mega TNF, 100ng/mL, Adipogen) Necrostatin-1s (1μM ...
-
No products found
because this supplier's products are not listed.
Karina Flores Montero, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and monoclonal mouse anti-alpha-tubulin (purified IgG) were from Synaptic Systems (Göttingen, Germany). The rabbit polyclonal anti-GST (purified IgG ...
-
No products found
because this supplier's products are not listed.
Kevin R Hughes, et al.,
bioRxiv - Microbiology 2019
Quote:
... and Quantitect murine TNF-R1 primer assay (Qiagen) or hypoxanthine– guanine phosphoribosyltransferase (HPRT ...
-
No products found
because this supplier's products are not listed.
Xianglei Yan, et al.,
bioRxiv - Immunology 2023
Quote:
... IFN-γ and TNF levels by ELISA kits (Mabtech, 3450-1H-6 ...
-
No products found
because this supplier's products are not listed.
Cristian V. Crisan, et al.,
bioRxiv - Microbiology 2023
Quote:
... and secondary antibodies against rabbit (for Hcp) and mouse (for RNA polymerase subunit alpha) (1:5000, LI-COR Biosciences). The membrane was imaged using a Biorad ChemiDoc imager and analyzed in FIJI.
-
No products found
because this supplier's products are not listed.
Thai Le,
bioRxiv - Synthetic Biology 2021
Quote:
... 2021: Escherichia coli DH5 alpha (Takara (Korea)) ...
-
No products found
because this supplier's products are not listed.
Rachel Lackie, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Protein expression was quantified using the Alpha Innotech software for the FluoroChemQ chemiluminescent exposure system (Alpha Innotech; GE Healthcare, London, ON, Canada) or ImageLab for ChemiDoc system (BioRad ...
-
No products found
because this supplier's products are not listed.
Apurva T. Prabhakar, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... CKII alpha’ Antibody 1:1000 (Bethyl; catalog no. A300-199A).
-
No products found
because this supplier's products are not listed.
Athina Kilpeläinen, et al.,
bioRxiv - Immunology 2021
Quote:
... and Goat anti-human IgA (alpha chain specific) (1/20000) (all from Jackson Immunoresearch). Secondary antibodies were incubated for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Angela Ballesteros, Kenton J. Swartz,
bioRxiv - Neuroscience 2021
Quote:
... we used oil immersion alpha Plan-Apochromat 63X/1.4 Oil Corr M27 objective (Carl Zeiss) and immersol 518F media (ne=1.518 (30°)) ...
-
No products found
because this supplier's products are not listed.
Vedavathi Madhu, et al.,
bioRxiv - Cell Biology 2024
Quote:
... For mouse primary antibody Mouse on Mouse Kit (Vector laboratories, BMK2202) was used for blocking and primary antibody incubation ...
-
No products found
because this supplier's products are not listed.
Andrew R. Morris, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and alpha fodrin/alpha-II spectrin (cat # BML-FG6090-0500, Enzo Life Sciences). Protein bands were visualized using horseradish peroxidase-conjugated anti-mouse or anti-rabbit IgG (Abcam ...
-
No products found
because this supplier's products are not listed.
Arnaud N’Guessan, et al.,
bioRxiv - Genomics 2022
Quote:
... and goat anti-human IgA (alpha chain) DyLight800 (Rockland Immunochemicals) antibodies at a final concentration of 0.1 μg/ml and 1 μg/ml ...
-
No products found
because this supplier's products are not listed.
Kathryn A. Jacobs, et al.,
bioRxiv - Cell Biology 2019
Quote:
... HRP-conjugated secondary antibodies (anti-rabbit, mouse Ig, mouse IgG1, mouse IgG2a, and mouse IgG2b) were purchased from Southern Biotech. Alexa-conjugated secondary antibodies were from Life Technologies.