-
No products found
because this supplier's products are not listed.
Ewa Bielczyk-Maczynska, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Recombinant human TNF-alpha (PeproTech/VWR) was used at a concentration of 10 ng/ml.
-
No products found
because this supplier's products are not listed.
Thomas Kehrer, et al.,
bioRxiv - Microbiology 2022
Quote:
... TNF-alpha treatments were performed for 45 min using 25 ng/ml of human TNF-alpha (Thermo Fisher). Cells were permeabilized with 0.1% Triton X in phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Sarah K. Sasse, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Recombinant Human TNF-alpha Protein purchased from R&D Systems was diluted in 1X Dulbecco’s phosphate buffered saline (DPBS ...
-
No products found
because this supplier's products are not listed.
Phillip M Mackie, et al.,
bioRxiv - Neuroscience 2021
Quote:
... TNF-alpha (Biolegend, 502908, PE, 1:100), IL1beta (Biolegend ...
-
No products found
because this supplier's products are not listed.
Christopher P Saxby, et al.,
bioRxiv - Bioengineering 2023
Quote:
... TNF-alpha (BD, Cat. # 563996), IL-2 (BioLegend ...
-
No products found
because this supplier's products are not listed.
Lana Frankle, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and TNF alpha (rabbit host, abcam). Blots were then washed in Tris-buffered saline with Tween-20 (TBST ...
-
No products found
because this supplier's products are not listed.
Nikita P. Patil, et al.,
bioRxiv - Physiology 2022
Quote:
... Tumor necrosis factor alpha (TNF-α, 20 ng/mL; Sigma-Aldrich) and cycloheximide (chx ...
-
No products found
because this supplier's products are not listed.
Livnat Jerby-Arnon, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... TNF-alpha (Miltenyi Biotec, Human TNF-α, Cat. No. 130-094-014) IFN-gamma (R&D systems ...
-
No products found
because this supplier's products are not listed.
Nontawat Chuinsiri, et al.,
bioRxiv - Physiology 2023
Quote:
... TNF-alpha (Merck); mouse monoclonal anti-CaSR (ab19347 ...
-
No products found
because this supplier's products are not listed.
José-María Díez, Carolina Romero, Rodrigo Gajardo,
bioRxiv - Immunology 2020
Quote:
... Human Anti-MERS-S2 IgG ELISA Kit (Alpha Diagnostic Intl. Inc.), against S2 subunit spike protein ...
-
No products found
because this supplier's products are not listed.
Han-Ming Wu, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... TNF Alpha Polyclonal Antibody (Proteintech, 17590-1-AP), and GAPDH antibody (Proteintech ...
-
No products found
because this supplier's products are not listed.
Nikhil Sharma, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and human TNF-α (16769S, Cell Signaling technologies) were used for treatment ...
-
No products found
because this supplier's products are not listed.
Allison D. Oliva, et al.,
bioRxiv - Neuroscience 2021
Quote:
... TNF alpha (0.5ng/mL final concentration in PBS, human recombinant, Stemcell Tech) was added to half of the wells ...
-
No products found
because this supplier's products are not listed.
Marco Tigano, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... TNF-alpha (200 ng ml−1, Invivogen), IFN-beta (5 ng ml−1 ...
-
No products found
because this supplier's products are not listed.
Peter F. Renz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Full length murine Tnf was PCR amplified from GFP-TNF-alpha plasmid (Addgene #28089) via Phusion PCR according to manufacturer’s protocol with the following primer ...
-
No products found
because this supplier's products are not listed.
Leopoldo F. M. Machado, Andrew Currin, Neil Dixon,
bioRxiv - Bioengineering 2019
Quote:
... coli DH5-alpha (NEB), transformation for induction test was made into E ...
-
No products found
because this supplier's products are not listed.
Ewa Bielczyk-Maczynska, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Recombinant human TNF-alpha (PeproTech/VWR) was used at a concentration of 10 ng/ml.
-
No products found
because this supplier's products are not listed.
George D. Moschonas, et al.,
bioRxiv - Microbiology 2023
Quote:
... culture medium was supplemented with recombinant human interferon-alpha 2 alpha (rhIFN-a2a) (#11343504, ImmunoTools), doxycycline (#D9891 ...
-
No products found
because this supplier's products are not listed.
Orthis Saha, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Alpha-LISA kits specific for human Aβ1–X (AL288C, PerkinElmer) and Aβ1–42 (AL276C ...
-
No products found
because this supplier's products are not listed.
Patrick Pagesy, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Anti-human GAPDH (sc-47724) and anti-alpha Tubulin (sc-8035) antibodies were from Santa Cruz.
-
No products found
because this supplier's products are not listed.
Musleh M. Muthana, et al.,
bioRxiv - Immunology 2023
Quote:
... Mouse TNF-alpha (Sino Biological Inc, 50349-MNAE). IgE ELISA Kit (Thermo Fisher Scientific/Invitrogen ...
-
No products found
because this supplier's products are not listed.
Michael J. Podolsky, et al.,
bioRxiv - Cell Biology 2023
Quote:
... human procollagen I alpha 1 (1:1,500; Novus Biologicals: AF6220), MYC (1:5,000 ...
-
No products found
because this supplier's products are not listed.
Dawei Zhou, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Human IFNα (alpha 2a) and IFNγ were purchased from PBL Assay Science. BD GolgiStop™ protein transport inhibitor was purchased from BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Cristina M. Failla, et al.,
bioRxiv - Cell Biology 2019
Quote:
... TNF-α) (BioRad). Data were analyzed using Bio-Plex Software Manager 6.1 ...
-
No products found
because this supplier's products are not listed.
Santoshi Muppala, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... monoclonal mouse anti-human alpha smooth muscle actin (M0851, Dako), monoclonal mouse anti-human CD68 (M0814 ...
-
No products found
because this supplier's products are not listed.
Hae Ryong Kwon, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... in alpha MEM (Corning) plus 10% FBS (mesenchymal stem cell-qualified ...
-
No products found
because this supplier's products are not listed.
Patricia Mendonca, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and tumor necrosis factor alpha (TNF-α) were purchased from RayBiotech (Norcross, Ga, USA). PCR primers and iScript advanced reverse transcriptase kit were purchased from Bio-Rad (Hercules ...
-
No products found
because this supplier's products are not listed.
Alexandra Thiran, et al.,
bioRxiv - Immunology 2023
Quote:
... and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT; tnf rev TCAAAATTCGAGTGACAAGCCTG) were used on LightCycler 480 (Roche). The reactions were performed in triplicates and the results were analyzed with qbase+ software ...
-
No products found
because this supplier's products are not listed.
Temistocles Molinar Jr., et al.,
bioRxiv - Molecular Biology 2022
Quote:
... alpha-factor peptide (GenScript) was added to a final concentration of 5 µg/ml for 1.5 hours ...
-
No products found
because this supplier's products are not listed.
I. Deniz Derman, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Alpha Tubulin (TUBA4A; Origene), and MUC5B (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Aaron R. Massey, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2015) Mice transgenic for human alpha-synuclein and deficient for murine alpha-synuclein (TgSNCAWT;Snca-/-) were obtained from Jackson Laboratories (#10710) and crossed with mice heterozygous for murine alpha synuclein (Snca+/-) ...
-
No products found
because this supplier's products are not listed.
Athina Kilpeläinen, et al.,
bioRxiv - Immunology 2021
Quote:
... and Goat anti-human IgA (alpha chain specific) (1/20000) (all from Jackson Immunoresearch). Secondary antibodies were incubated for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
John Tyler Sandberg, et al.,
bioRxiv - Immunology 2021
Quote:
To assess memory T cell responses to SARS-CoV-2 in convalescent COVID-19 patient samples we utilized Human IFN-γ/IL-2/TNF FluoroSpot kit (Mabtech), which allows for the detection of T cells producing IFN-γ ...
-
No products found
because this supplier's products are not listed.
Kevin R Hughes, et al.,
bioRxiv - Microbiology 2019
Quote:
... and Quantitect murine TNF-R1 primer assay (Qiagen) or hypoxanthine– guanine phosphoribosyltransferase (HPRT ...
-
No products found
because this supplier's products are not listed.
Thai Le,
bioRxiv - Synthetic Biology 2021
Quote:
... 2021: Escherichia coli DH5 alpha (Takara (Korea)) ...
-
No products found
because this supplier's products are not listed.
Roberto R. Moraes Barros, et al.,
bioRxiv - Microbiology 2021
Quote:
... knowlesi elongation factor-1 alpha (pkef1-alpha) 5’ UTR were isolated from agarose gels and cloned into the pGEM-T vector (Promega, Madison, WI, USA). To replace the pfcam 5’ UTR sequence that drives luciferase transcription in the pD-pfcam-Luc ...
-
No products found
because this supplier's products are not listed.
Ramona Jühlen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FADS 1 cells were grown in MEM Alpha (Lonza, Basel, Switzerland) supplemented with 15% FBS and 1% pen/strep ...
-
No products found
because this supplier's products are not listed.
Nikhil Pandey, Priyanka Mishra,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... digital vernacular calliper(Mavotank Pvt ltd),For biochemical procedure-Mouse TNF alpha ELISA kit was purchased from Elabscience (E-EL-M3063), TRIzol (Ambion),TURBO DNA-free Kit (Invitrogen),RevertAid First Strand cDNA Synthesis kit (Thermo scientific).
-
No products found
because this supplier's products are not listed.
Laurence Glennon-Alty, et al.,
bioRxiv - Immunology 2020
Quote:
... TNF (10 ng/mL, Calbiochem), IFNαA2 (0.1-20 ng/mL ...
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... SIRP alpha (SIA-H52A8; Acrobiosystems), GITR (GIR-H5254 ...
-
No products found
because this supplier's products are not listed.
Apurva T. Prabhakar, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... CKII alpha’ Antibody 1:1000 (Bethyl; catalog no. A300-199A).
-
No products found
because this supplier's products are not listed.
Daniela C. Ivan, et al.,
bioRxiv - Immunology 2020
Quote:
... epithelial cells are stimulated whether with 10ng/ml TNF-α (PromoCell, GmbH, Heidelberg, Germany) or with 100IU/ml IFN-γ (PeproTech ...
-
No products found
because this supplier's products are not listed.
Qing Zhao, et al.,
bioRxiv - Immunology 2023
Quote:
Biotinylated Goat F(ab)2 anti-human isotype antibodies (anti-human IgM, SouthernBiotech, Cat # 2022-01; anti-human IgA, SouthernBiotech, Cat # 2052-01 ...
-
No products found
because this supplier's products are not listed.
Shu Liu, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Human primary astrocytes (ScienCell) were cultivated as recommended by ScienCell ...
-
No products found
because this supplier's products are not listed.
Yujen Wang, et al.,
bioRxiv - Biophysics 2020
Quote:
... including 5mM CaCl2 (Human Alpha Thrombin, Enzyme Research Laboratories) to obtain a pre-gel fibrin solution ...
-
No products found
because this supplier's products are not listed.
Olivier Thouvenin, et al.,
bioRxiv - Biophysics 2019
Quote:
... and alpha-bungarotoxin (TOCRIS) were injected in the center of the diencephalic ventricle in order to label CSF and paralyze the fish in a single injection ...
-
No products found
because this supplier's products are not listed.
Priya Khurana, et al.,
bioRxiv - Immunology 2021
Quote:
... containing 500ng/mL alpha-galactosylceramide (Cayman Chemicals; KRN7000) and 50U/mL recombinant IL-2 (PeproTech) ...
-
No products found
because this supplier's products are not listed.
Rachel Lackie, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Protein expression was quantified using the Alpha Innotech software for the FluoroChemQ chemiluminescent exposure system (Alpha Innotech; GE Healthcare, London, ON, Canada) or ImageLab for ChemiDoc system (BioRad ...
-
No products found
because this supplier's products are not listed.
Angela Ballesteros, Kenton J. Swartz,
bioRxiv - Neuroscience 2021
Quote:
... we used oil immersion alpha Plan-Apochromat 63X/1.4 Oil Corr M27 objective (Carl Zeiss) and immersol 518F media (ne=1.518 (30°)) ...
-
No products found
because this supplier's products are not listed.
Anthony A. Ruberto, et al.,
bioRxiv - Genomics 2021
Quote:
... primary human hepatocytes (BioIVT) were seeded 2-3 days prior to infection with 15,000-20,000 sporozoites per well ...