-
No products found
because this supplier's products are not listed.
Ewa Bielczyk-Maczynska, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Recombinant human TNF-alpha (PeproTech/VWR) was used at a concentration of 10 ng/ml.
-
No products found
because this supplier's products are not listed.
Thomas Kehrer, et al.,
bioRxiv - Microbiology 2022
Quote:
... TNF-alpha treatments were performed for 45 min using 25 ng/ml of human TNF-alpha (Thermo Fisher). Cells were permeabilized with 0.1% Triton X in phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Sarah K. Sasse, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Recombinant Human TNF-alpha Protein purchased from R&D Systems was diluted in 1X Dulbecco’s phosphate buffered saline (DPBS ...
-
No products found
because this supplier's products are not listed.
Phillip M Mackie, et al.,
bioRxiv - Neuroscience 2021
Quote:
... TNF-alpha (Biolegend, 502908, PE, 1:100), IL1beta (Biolegend ...
-
No products found
because this supplier's products are not listed.
Christopher P Saxby, et al.,
bioRxiv - Bioengineering 2023
Quote:
... TNF-alpha (BD, Cat. # 563996), IL-2 (BioLegend ...
-
No products found
because this supplier's products are not listed.
Lana Frankle, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and TNF alpha (rabbit host, abcam). Blots were then washed in Tris-buffered saline with Tween-20 (TBST ...
-
No products found
because this supplier's products are not listed.
Nikita P. Patil, et al.,
bioRxiv - Physiology 2022
Quote:
... Tumor necrosis factor alpha (TNF-α, 20 ng/mL; Sigma-Aldrich) and cycloheximide (chx ...
-
No products found
because this supplier's products are not listed.
Musleh M. Muthana, et al.,
bioRxiv - Immunology 2023
Quote:
... Mouse TNF-alpha (Sino Biological Inc, 50349-MNAE). IgE ELISA Kit (Thermo Fisher Scientific/Invitrogen ...
-
No products found
because this supplier's products are not listed.
Livnat Jerby-Arnon, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... TNF-alpha (Miltenyi Biotec, Human TNF-α, Cat. No. 130-094-014) IFN-gamma (R&D systems ...
-
No products found
because this supplier's products are not listed.
Nontawat Chuinsiri, et al.,
bioRxiv - Physiology 2023
Quote:
... TNF-alpha (Merck); mouse monoclonal anti-CaSR (ab19347 ...
-
No products found
because this supplier's products are not listed.
Alexander J. Finney, et al.,
bioRxiv - Microbiology 2019
Quote:
... Nitrocellulose membranes were challenged with an anti-His-HRP antibody (Alpha Diagnostics) and a GeneGnome instrument (SynGene ...
-
No products found
because this supplier's products are not listed.
Han-Ming Wu, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... TNF Alpha Polyclonal Antibody (Proteintech, 17590-1-AP), and GAPDH antibody (Proteintech ...
-
No products found
because this supplier's products are not listed.
Peter F. Renz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Full length murine Tnf was PCR amplified from GFP-TNF-alpha plasmid (Addgene #28089) via Phusion PCR according to manufacturer’s protocol with the following primer ...
-
No products found
because this supplier's products are not listed.
Nikhil Sharma, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and human TNF-α (16769S, Cell Signaling technologies) were used for treatment ...
-
No products found
because this supplier's products are not listed.
Ewa Bielczyk-Maczynska, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Recombinant human TNF-alpha (PeproTech/VWR) was used at a concentration of 10 ng/ml.
-
No products found
because this supplier's products are not listed.
Allison D. Oliva, et al.,
bioRxiv - Neuroscience 2021
Quote:
... TNF alpha (0.5ng/mL final concentration in PBS, human recombinant, Stemcell Tech) was added to half of the wells ...
-
No products found
because this supplier's products are not listed.
Leopoldo F. M. Machado, Andrew Currin, Neil Dixon,
bioRxiv - Bioengineering 2019
Quote:
... coli DH5-alpha (NEB), transformation for induction test was made into E ...
-
No products found
because this supplier's products are not listed.
Marco Tigano, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... TNF-alpha (200 ng ml−1, Invivogen), IFN-beta (5 ng ml−1 ...
-
No products found
because this supplier's products are not listed.
Deepti Mudaliar, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Recombinant Human CKII alpha prime polypeptide His Protein (NBP2-22736) was purchased from Novus Biologicals (Centennial, CO, USA). CK2 Substrate (synthetic peptide RRRADDSDDDDD ...
-
No products found
because this supplier's products are not listed.
ChangDong Lin, et al.,
bioRxiv - Immunology 2020
Quote:
... Streptavidin-coated Alpha donor beads or anti-His-conjugated AlphaLISA acceptor beads (PerkinElmer) were used at a final concentration of 10 μg/mL per well ...
-
No products found
because this supplier's products are not listed.
EJ Lawrence, S Chatterjee, M Zanic,
bioRxiv - Cell Biology 2022
Quote:
Human His-CLASP1 (NM_015282.2) in pFastBacHT vector was purchased from Genscript. The cDNA encoding full-length human CLASP2α was purchased from Dharmacon (Accession ...
-
No products found
because this supplier's products are not listed.
Weihua Qin, et al.,
bioRxiv - Cell Biology 2022
Quote:
... His- tagged human UHRF1 was purified using Ni-NTA sepharose resin (Qiagen). Recombinant E1 (His-UBE1) ...
-
No products found
because this supplier's products are not listed.
Zachary R. Crook, et al.,
bioRxiv - Bioengineering 2024
Quote:
... biotinylated His-Avi-tagged human TfR (TfR cross-reactivity, ACROBiosystems TFR-H82E5); His-tagged mouse TfR (TfR cross-reactivity ...
-
No products found
because this supplier's products are not listed.
George D. Moschonas, et al.,
bioRxiv - Microbiology 2023
Quote:
... culture medium was supplemented with recombinant human interferon-alpha 2 alpha (rhIFN-a2a) (#11343504, ImmunoTools), doxycycline (#D9891 ...
-
No products found
because this supplier's products are not listed.
Patrick Pagesy, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Anti-human GAPDH (sc-47724) and anti-alpha Tubulin (sc-8035) antibodies were from Santa Cruz.
-
No products found
because this supplier's products are not listed.
Cristina M. Failla, et al.,
bioRxiv - Cell Biology 2019
Quote:
... TNF-α) (BioRad). Data were analyzed using Bio-Plex Software Manager 6.1 ...
-
No products found
because this supplier's products are not listed.
Simon Bressendorff, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... His (Clontech), supplemented with 1.5 mM 3-amino-1,2,4-triazol (3-AT ...
-
No products found
because this supplier's products are not listed.
Beata M. Walter, et al.,
bioRxiv - Molecular Biology 2022
Quote:
His-Prs was purified on His-Trap columns (GE Healthcare) as described above and dialyzed overnight at 20 °C into 1 x acetylation buffer (100 mM Tris-HCl pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Santoshi Muppala, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... monoclonal mouse anti-human alpha smooth muscle actin (M0851, Dako), monoclonal mouse anti-human CD68 (M0814 ...
-
No products found
because this supplier's products are not listed.
Dawei Zhou, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Human IFNα (alpha 2a) and IFNγ were purchased from PBL Assay Science. BD GolgiStop™ protein transport inhibitor was purchased from BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Alexandra Thiran, et al.,
bioRxiv - Immunology 2023
Quote:
... and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT; tnf rev TCAAAATTCGAGTGACAAGCCTG) were used on LightCycler 480 (Roche). The reactions were performed in triplicates and the results were analyzed with qbase+ software ...
-
No products found
because this supplier's products are not listed.
Patricia Mendonca, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and tumor necrosis factor alpha (TNF-α) were purchased from RayBiotech (Norcross, Ga, USA). PCR primers and iScript advanced reverse transcriptase kit were purchased from Bio-Rad (Hercules ...
-
No products found
because this supplier's products are not listed.
Shraddha Pai, et al.,
bioRxiv - Genomics 2021
Quote:
We downloaded publicly-available Hi-C data from human prefrontal cortex tissue23,24 (Illumina HiSeq 2000 paired-end raw sequence reads ...
-
No products found
because this supplier's products are not listed.
Francesco Vallania, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Cells were frozen in 10% DMSO/10% heat inactivated (HI) human AB serum (Corning) for later flow cytometry staining ...
-
No products found
because this supplier's products are not listed.
Kazuhiro Yamamoto, et al.,
bioRxiv - Cell Biology 2022
Quote:
... recombinant human HMGB2 (C-terminal His tag, TP720732) from ORIGENE (Rockville, MD); anti-rabbit alkaline phosphatase-linked antibody ...
-
No products found
because this supplier's products are not listed.
Ana F. Ferreira, et al.,
bioRxiv - Neuroscience 2023
Quote:
Human samples: qPCR experiments were conducted using the SensiFAST Probe Hi-ROX Master Mix (Bioline) and the TaqMan Gene Expression Assays (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Pille Hallast, et al.,
bioRxiv - Genomics 2023
Quote:
... Hi-C libraries using 1.5 M human cells as input were generated with Proximo Hi-C kits v4.0 (Phase Genomics, Seattle, WA) following the manufacturer’s protocol with the following modification ...
-
No products found
because this supplier's products are not listed.
Simona Selberg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Recombinant human FTO protein was labeled with His-tag using Monolith His-Tag Labeling Kit RED-tris-NTA (NanoTemper Technologies GmbH; MO-L008). The labelled FTO protein (target ...
-
No products found
because this supplier's products are not listed.
Brianna Romer, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 15 mg of His-Tev-HaloTag-(3C)-human γ-TuNA was coupled to Halo Magne beads (Promega). Xenopus laevis egg extract was prepared by standard methods28 ...
-
No products found
because this supplier's products are not listed.
Ramona Jühlen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FADS 1 cells were grown in MEM Alpha (Lonza, Basel, Switzerland) supplemented with 15% FBS and 1% pen/strep ...
-
No products found
because this supplier's products are not listed.
Sanchita Mishra, et al.,
bioRxiv - Immunology 2024
Quote:
... 100ng ml-1 recombinant human TNF-α(Abclonal, RP00001) was added.Tb1 Lu cells were treated with 30µM Z-VAD(OMe)-FMK and 1µM SM-164 2 hours before treatment with 100ng ml-1 TNF-α ...
-
No products found
because this supplier's products are not listed.
Aaron R. Massey, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2015) Mice transgenic for human alpha-synuclein and deficient for murine alpha-synuclein (TgSNCAWT;Snca-/-) were obtained from Jackson Laboratories (#10710) and crossed with mice heterozygous for murine alpha synuclein (Snca+/-) ...
-
No products found
because this supplier's products are not listed.
Athina Kilpeläinen, et al.,
bioRxiv - Immunology 2021
Quote:
... and Goat anti-human IgA (alpha chain specific) (1/20000) (all from Jackson Immunoresearch). Secondary antibodies were incubated for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
John Tyler Sandberg, et al.,
bioRxiv - Immunology 2021
Quote:
To assess memory T cell responses to SARS-CoV-2 in convalescent COVID-19 patient samples we utilized Human IFN-γ/IL-2/TNF FluoroSpot kit (Mabtech), which allows for the detection of T cells producing IFN-γ ...
-
No products found
because this supplier's products are not listed.
Brian L. Hie, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... His-tagged antigens using Anti-Penta-HIS biosensors (Sartorius/ForteBio). Antigen was loaded to a threshold of 1 nm shift ...
-
No products found
because this supplier's products are not listed.
Marco Di Gioia, et al.,
bioRxiv - Immunology 2023
Quote:
... His-tagged recombinant human AKT1 (BPS Bioscience, Cat# 40003), AKT2 (BPS Bioscience ...
-
No products found
because this supplier's products are not listed.
Francesca Salvatori, et al.,
bioRxiv - Neuroscience 2020
Quote:
... coli 5-alpha Chemically Competent cells (Lucigen), performing a thermal shock for 45 seconds at 42°C followed by 2 minutes on ice ...
-
No products found
because this supplier's products are not listed.
Carole Seguin-Devaux, et al.,
bioRxiv - Immunology 2024
Quote:
... or rabbit anti-His (Bethyl, ImTec Diagnostic NV ...
-
No products found
because this supplier's products are not listed.
Daniela C. Ivan, et al.,
bioRxiv - Immunology 2020
Quote:
... epithelial cells are stimulated whether with 10ng/ml TNF-α (PromoCell, GmbH, Heidelberg, Germany) or with 100IU/ml IFN-γ (PeproTech ...
-
No products found
because this supplier's products are not listed.
Qing Zhao, et al.,
bioRxiv - Immunology 2023
Quote:
Biotinylated Goat F(ab)2 anti-human isotype antibodies (anti-human IgM, SouthernBiotech, Cat # 2022-01; anti-human IgA, SouthernBiotech, Cat # 2052-01 ...