-
No products found
because this supplier's products are not listed.
Wenning Chu, et al.,
bioRxiv - Bioengineering 2023
Quote:
... flowthrough and elution fractions collected as described in Section 2.6 were determined using a HEK 293 HCP ELISA kit (Cygnus Technologies, Southport, NC) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Negin Khosraviani, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Human embryonic kidney 293 cells (HEK293T) were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Wisent Bioproducts) supplemented with 10% (v/v ...
-
No products found
because this supplier's products are not listed.
Julian A. Harris, et al.,
bioRxiv - Biochemistry 2021
Quote:
... A single bicistronic baculovirus encoding the human Gβ1 subunit with a N-terminal 6x His-tag and rhinovirus 3C protease site and untagged human Gγ2 subunit was generated using the BestBac method (Expression systems) in Spodoptera frugiperda (Sf9 ...
-
No products found
because this supplier's products are not listed.
Michael G. Spelios, et al.,
bioRxiv - Immunology 2021
Quote:
... purified His-tagged ACE2 (EpiGentek) was added at a concentration of 100 ng/well (prepared with PBS ...
-
No products found
because this supplier's products are not listed.
Xian Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... Human B cell proliferation was measured by 3[H]-thymidine incorporation (1 μCi/mL) (American Radiolabeled Chemicals).
-
No products found
because this supplier's products are not listed.
Anil Verma, et al.,
bioRxiv - Immunology 2023
Quote:
... were labeled with biotinylated anti-His tag monoclonal antibody (ThermoScientific) and used to capture His-tagged clade C gp120 Du151 protein (Immune Technologies). The gp120-expressing beads were then incubated with triplicate 5-fold dilutions of heat-inactivated serum samples in V-bottom plates for 1h at 37°C ...
-
No products found
because this supplier's products are not listed.
Can Tan, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... cleared with FocusClear (CelExplorer Labs #FC-101) and mounted on slides in mounting medium.
-
No products found
because this supplier's products are not listed.
Madeleine F. Jennewein, et al.,
bioRxiv - Immunology 2021
Quote:
To investigate Fc receptor binding recombinant Fc receptors with an AviTag were biotinylated using a Bir500 kit (Avidity, Aurora, CO, USA) according to manufacturer’s instructions and purified using a Zeba Spin Desalting Column ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Kanae Tsubotani, et al.,
bioRxiv - Biochemistry 2021
Quote:
... FITC-labelled lysozyme (LS1-FC-1, Nanocs Inc., USA) instead of lysozyme was mixed with ovalbumin in 5mM Tris buffer (pH 7.4) ...
-
Recombinant Antigen
Cat# REC31697-100,
100µg USD $519.0
Ask
Maya Imbrechts, et al.,
bioRxiv - Immunology 2021
Quote:
... Spike Glycoprotein (Full-Length)-His (REC31868-500, The Native Antigen Company). Briefly ...
-
WB, IF,ELISA
Cat# A5199, SKU# A5199-20ul,
20ul, $47.00
Ask
Xuxiao He, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and Nickel Magnetic Beads for His tag protein purification (Bimake, B23602) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Abhinav Parivesh, et al.,
bioRxiv - Cell Biology 2022
Quote:
HEK-293T cells were seeded at 2.5×106 in 25ml of DMEM (Genesee Cat. 25-500) completed with 10% heat-inactivated FBS (Thermo Cat ...
-
WB, ELISA
Cat# CDC-41,
0.1 mg, Inquire
Ask
Ilaria Frasson, et al.,
bioRxiv - Microbiology 2023
Quote:
... We conducted genome-wide negative selection (dropout) screens in Cas9-Calu-3 cells by using the human GeCKO v2 library (Creative Biogene, cat. CCLV0001) that targets 18823 genes with 6 gRNAs/gene as well as 1000 non-targeting gRNAs ...
-
No products found
because this supplier's products are not listed.
Bas W.A. Bögels, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide HCl (EDC, Carbosynth), 1,6-diaminohexane (Sigma ...
-
No products found
because this supplier's products are not listed.
K Abhijith, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... HEK 293T cell line was a generous gift from Dr Jomon Joseph (National Centre for Cell Science, Pune, India). The cells were grown in DMEM with high glucose and sodium pyruvate (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Claudia Prahst, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 3% BSA (Nzytech), 0.5% Triton X100 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... 3-oxoLCA (Steraloids (C1750-000 ...
-
No products found
because this supplier's products are not listed.
Maria E. Candela, et al.,
bioRxiv - Immunology 2021
Quote:
Treatments with HBD3 peptide(s) was after 15-30 minutes 5 μg/ml of human β-Defensin-3 (hBD3) (Peptide Institute Inc., PeptaNova GmbH #4382-s), or 5 μg/ml of Linear Defensin (Almac Sciences Scotland Ltd ...
-
No products found
because this supplier's products are not listed.
Balaji Karthick Subramanian, et al.,
bioRxiv - Pathology 2019
Quote:
... Human primary podocytes from Celprogen Inc ...
-
No products found
because this supplier's products are not listed.
Alexa Schuettenberg, et al.,
bioRxiv - Immunology 2022
Quote:
... normal human IgG (ProSci #5503) on each plate as a positive control ...
-
No products found
because this supplier's products are not listed.
Peeali Mukherjee, et al.,
bioRxiv - Biophysics 2023
Quote:
... Crystals of FlrB-PAS7-108 were obtained by hanging drop vapour diffusion method at 293 K using 24 well crystallization tray with Ammonium Sulfate Grid Screen from Hampton Research with protein of concentration 10 mg ml-1 ...
-
No products found
because this supplier's products are not listed.
Dalia Rosano, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... HEK-293T cells were transfected with cellecta CloneTracker XP library and ready-to-use lentiviral packaging plasmid mix (Cellecta, CPCP-K2A) using Lipofectamine (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Manuel Göpferich, et al.,
bioRxiv - Neuroscience 2020
Quote:
... human FGF (20 ng/μl, ReliaTech) and human EGF (Promokine) ...
-
No products found
because this supplier's products are not listed.
Hazel Stewart, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Pacific Blue-conjugated anti-CD71 (Exbio, MEM-75, FC 1 μg / 100 μl / 106 cells), StrepMAB-Classic (IBA LifeSciences ...
-
No products found
because this supplier's products are not listed.
Yan Tang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Human and mouse MDK ELISA assays were performed using Human Midkine ELISA Kit PicoKine™ (EK1235, BOSTER) and Mouse MDK / Midkine (Sandwich ELISA ...
-
LC Laboratories' Product Number R-8200 - Ribociclib, Free Base (Lee011, CAS 1211441-98-3), >99%...
Cat# R-8200, SKU# R-8200_100mg,
100 mg, $127.00
Ask
Rohan N. Shah, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3 µM CHIR99021 (LC Laboratories), 1 µM PD0325901 (LC Laboratories) ...
-
No products found
because this supplier's products are not listed.
Sherine E. Thomas, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Wizard 3&4 (Molecular Dimensions), JCSG +Suite (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Lior Tal, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Arabidopsis KAI2 protein was expressed as a 6× His-SUMO fusion protein using the expression vector pSUMO (LifeSensors). His-SUMO-KAI2 was isolated from by Ni-NTA resin and the eluted His-SUMO KAI2 was further separated by anion-exchange ...
-
No products found
because this supplier's products are not listed.
Thi K. Tran-Nguyen,
bioRxiv - Molecular Biology 2021
Quote:
Recombinant human GRP78s purchased from StressMarq Biosciences or produced in the laboratory [30] were used as antigens in ELISA ...
-
No products found
because this supplier's products are not listed.
Nazila V. Jafari, Jennifer L. Rohn,
bioRxiv - Microbiology 2022
Quote:
HBLAK human bladder progenitor cells (CELLnTEC, Switzerland) were grown according to the CELLnTEC protocol ...
-
No products found
because this supplier's products are not listed.
Yuichi Mitsui, et al.,
bioRxiv - Immunology 2022
Quote:
Human PBMCs were purchased from Precision for Medicine, Inc ...
-
No products found
because this supplier's products are not listed.
Csaba Matta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-MMP-3 (Aviva Systems Biology ARP42042_P050), anti-MMP-13 (Aviva Systems Biology ARP56350_P050) ...
-
CD366/Tim-3 Antibody (PE) is a Mouse Monoclonal Antibody against CD366/Tim-3.
Cat# abx229419-50T,
50 tests USD $232.0
Ask
José-María Díez, Carolina Romero, Rodrigo Gajardo,
bioRxiv - Immunology 2020
Quote:
The following kits were used for the qualitative determination of IgG class antibodies against human coronaviruses: abx052609 Human Coronavirus IgG ELISA kit (Abbexa, Cambridge, UK), against an undetermined antigen ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Asha A. Philip, John T. Patton,
bioRxiv - Microbiology 2022
Quote:
... A puc19 plasmid containing a RIX/NSP3-2A-P-His insert under the control of a T7 transcription promoter (puc19/T7/ RIX/NSP3-2A-P-His) was purchased from Bio Basic Canada Inc ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Huu Tuan Nguyen, et al.,
bioRxiv - Bioengineering 2023
Quote:
Human umbilical vein endothelial cells (ECs, Angio-Proteomie, MA, USA) were cultured in Vasculife (LifeLine Cell Technology ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Ida M. Modvig, et al.,
bioRxiv - Physiology 2019
Quote:
... Radioactive labeled rat and human secretin was obtained from Phoenix Pharmaceuticals, Inc (cat no ...
-
No products found
because this supplier's products are not listed.
Amy L. Kimble, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Frozen mouse and human brain tissues were mechanically homogenized (Next Advance Bullet Blender BB724M with 3.2 mm stainless steel beads using setting 4 for 4min at 4C) ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Zhexin Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 3 times at 10,000 rpm for 5 s (IKA TC10 basic ULTRA-TURRAX® homogenizer with S10N-5G dispersing element ...
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... a polyethylene tubing (3 mm inner diameter; A-M Systems), which acted as the active electrode for tRNS ...
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...
-
No products found
because this supplier's products are not listed.
Matthias Schmidt, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3-hydroxy-2,4-dimethylhexanoic acid were synthesized by Enamine (Ukraine).
-
No products found
because this supplier's products are not listed.
Kosuke Fukui, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and desalted by Spectra/Por® Dialysis Membrane 3 (Spectrum Labs, USA) with Buffer IV (10 mM NaCl ...
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...
-
No products found
because this supplier's products are not listed.
Sebastián Cerminati, et al.,
bioRxiv - Bioengineering 2021
Quote:
Fed-batch fermentations were carried out in 3 L (New Brunswick Bio Flo 115, USA) fermenters ...