-
No products found
because this supplier's products are not listed.
Andrew R.M. Michael, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Sulfo-NHS-LC-Biotin (Sulfo-Biotin-NHS, Thermo Fisher Scientific) and crosslinkers DSS (Cayman Chemical ...
-
No products found
because this supplier's products are not listed.
Osamu Baba, et al.,
bioRxiv - Pathology 2020
Quote:
... Sulfo-Cyanine5 NHS ester (sulfo-Cy5-NHS-ester) was purchased from Lumiprobe (Catalog #: 13320). CF640R Succinimidyl Ester (CF640R-NHS-ester ...
-
No products found
because this supplier's products are not listed.
Trung The Tran, et al.,
bioRxiv - Immunology 2022
Quote:
... Purified recombinant viral proteins were solubilized in PBS and biotinylated chemically with sulfo-NHS-LC-biotin (sulfo-NHS-LC-biotin, Proteochem, USA) at a molar ratio of 1:1 ...
-
No products found
because this supplier's products are not listed.
Lacey A Perdue, et al.,
bioRxiv - Bioengineering 2020
Quote:
... DBCO-sulfo-NHS ester (Sigma) in PBS was added at 5 eq ...
-
No products found
because this supplier's products are not listed.
Michael J. Cohen, et al.,
bioRxiv - Cell Biology 2020
Quote:
Cytosolic lysate was covalently modified with or without 1mg/mL sulfo-NHS-LC biotin (ApexBio) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Lea Melzener, et al.,
bioRxiv - Bioengineering 2023
Quote:
... N-hydroxysulfosuccinimide sodium salt (sulfo-NHS; TCI) and 1-Ethyl-3-(3-dimethylaminopropyl ...
-
No products found
because this supplier's products are not listed.
Laurell Kessler, et al.,
bioRxiv - Biophysics 2024
Quote:
... The DBCO-sulfo-NHS ester linker (Jena Bioscience, Germany) was dissolved in dimethylformamide (DMF ...
-
No products found
because this supplier's products are not listed.
Emily H. Adhikari, et al.,
bioRxiv - Immunology 2023
Quote:
... was biotinylated with sulfosuccinimidyl-6-[biotinamido]-6-hexanamido hexanoate (sulfo-NHS-LC-LC biotin; ThermoScientific) and coupled to streptavidin beads (New England Biolabs). Patient samples were incubated with RBD-coupled beads and excess sera washed off with PBS (Sigma) ...
-
No products found
because this supplier's products are not listed.
Benedikt K. Rossboth, et al.,
bioRxiv - Biophysics 2019
Quote:
... The mAb TS2/4-biotin was purified from an excess of NHS-LC-LC-Biotin via gel filtration (Superdex-200 10/300; GE Healthcare Life Sciences), concentrated using Amicon Ultra-4 centrifugal filters (10 kDa cut-off ...
-
No products found
because this supplier's products are not listed.
Dominic A. Helmerich, Gerti Beliu, Markus Sauer,
bioRxiv - Biophysics 2020
Quote:
... was labeled with Biotin-NHS (Merck, 203112). Therefore 100 µg of 1g/l primary antibody were treated according to the labeling protocol above using 250 µg of Biotin-NHS ...
-
No products found
because this supplier's products are not listed.
Anugraha Rajagopalan, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Antibody was modified with DBCO-Sulfo-NHS ester (Click Chemistry Tools, #A124) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Juan A. Perez-Bermejo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Purified 53BP1 Tudor domain was labeled at exposed primary amine groups with NHS-biotin using ChromaLINK NHS-Biotin protein labeling kit (Vector Laboratories). 1 equivalent of chromalink biotin was incubated with the 53BP1 Tudor domain for 2 h and buffer exchanged into fresh PBS ...
-
No products found
because this supplier's products are not listed.
Markus Brandhofer, et al.,
bioRxiv - Immunology 2022
Quote:
... Biotinylated human MIF was produced using D-biotinoyl- ε -aminocaproic acid-N-hydroxy-succinimide ester (Biotin-7-NHS) with the Biotin Protein Labeling Kit from Roche (Mannheim, Germany). Alternatively ...
-
LC Laboratories' Product Number O-5857 - Okadaic Acid, Sodium Salt (Halochondrine A, Sodium...
Cat# O-5857, SKU# O-5857_300ug,
300 ug, $228.00
Ask
Nir Erez, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and HDAC inhibitors (20mM Sodium butyrate, Sigma 303410 and 10uM Vorinostat, LC Laboratories V-8477), followed by centrifugation at 3000 rpm for 3 min ...
-
No products found
because this supplier's products are not listed.
Charlotte Degorre, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Biopsy sections were deparaffinized and antigens were retrieved by boiling in 10mM sodium citrate buffer pH6 for 40 minutes followed by endogenous biotin blocking (Agilent) and normal goat serum blocking (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Nicholas Spidale, et al.,
bioRxiv - Immunology 2019
Quote:
... then endogenous biotin was blocked using the Avidin/Biotin Blocking System (BioLegend) as recommended ...
-
No products found
because this supplier's products are not listed.
Giulio Di Minin, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Cells were incubated for 30 min with Sulfo-NHS-SS-Biotin (Covachem, #14207) on ice and lysed in Membrane lysis buffer ...
-
No products found
because this supplier's products are not listed.
Andrew R.M. Michael, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Biotin-X-NHS (Biotin-NHS, Cayman Chemical), Sulfo-NHS-LC-Biotin (Sulfo-Biotin-NHS ...
-
No products found
because this supplier's products are not listed.
Tinotenda Gwisai, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Sulfo-DBCO-NHS ester was purchased from Broadpharm (San Diego, CA).
-
No products found
because this supplier's products are not listed.
Lutgarde Serneels, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and TS-XX-biotin ethylenediamine (biotin-XX ethylenediamine thiosulfate, sodium salt, Biotium) (500 µM ...
-
No products found
because this supplier's products are not listed.
Mark R. MacRae, et al.,
bioRxiv - Biophysics 2022
Quote:
... the purified and concentrated protein was incubated with 1:3 protein to biotin ratio of 1mM NHS-PEG4-Biotin (VWR #PI21362) for 1 hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Advika Kamatar, et al.,
bioRxiv - Biophysics 2023
Quote:
His-FUS LC was labeled with Atto-488 or Atto-647 NHS-ester fluorescent dyes (ATTO-TEC, Sigma-Alrich). Labeling occurred at or near the N-terminus because only the N-terminus and a lysine at residue position 5 in the leader sequence preceding the N-terminal region hexa-histidine tag were expected to react with the NHS-functionalized dye ...
-
No products found
because this supplier's products are not listed.
Heng-Yi Chen, et al.,
bioRxiv - Immunology 2021
Quote:
... 0.05% sodium azide) and incubated with Fc-receptor blocking antibody 2.4G2 (5 µg/mL; BioXCell, Lebanon, NH) for at least 10 mins on ice ...
-
No products found
because this supplier's products are not listed.
Seline A. Zwarthoff, et al.,
bioRxiv - Immunology 2021
Quote:
... DNP-NH-PEG(4)-NHS (Iris Biotech) was reacted at a concentration of 5 mM in PBS-T with the aminated surface to reach a coupling density of 250 reponse units (RU) ...
-
No products found
because this supplier's products are not listed.
Charles Brent Wakefield, et al.,
bioRxiv - Physiology 2021
Quote:
... ELISAs (ALPCO, NH, USA) were performed following the manufacturer’s protocol for insulin ...
-
No products found
because this supplier's products are not listed.
Luis Baudouin-Gonzalez, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Tyramide biotin amplification (TSA Plus Biotin Kit, Perkin Elmer) was performed for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Joshua Mayoral, et al.,
bioRxiv - Microbiology 2021
Quote:
... and biotin with anti-biotin (Abcam, ab53494, 1:1000). Appropriate secondary antibodies conjugated to Alexa Fluorophores 488 ...
-
No products found
because this supplier's products are not listed.
Roland Imle, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... anti-c-myc-biotin and anti-biotin-PE (Miltenyi Biotec, 130-124-899 and 130-111-068 ...
-
No products found
because this supplier's products are not listed.
Bo Li, et al.,
bioRxiv - Neuroscience 2020
Quote:
... LC MS used a Shimadzu LC Nexera X2 UHPLC coupled with a QTRAP 5500 LC MS (AB Sciex). An ACQUITY UPLC BEH Amide analytic column (2.1 × 50 mm ...
-
No products found
because this supplier's products are not listed.
Robin S. Lindsay, et al.,
bioRxiv - Immunology 2021
Quote:
... MHCII Biotin (BD) + Streptavidin Qdot605 (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Edward B. Irvine, et al.,
bioRxiv - Immunology 2023
Quote:
... 500μM biotin (Avidity) was then added at a 1:100 ratio relative to the total solution volume and incubated rotating for 10min at RT ...
-
No products found
because this supplier's products are not listed.
Yann Benureau, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and biotin (mouse anti-biotin 1/6,000, Jackson ImmunoResearch #200-002-211). PLA and EdU counterstaining were performed according to the manufacturer’s instructions using the Duolink In Situ Red kit (Sigma ...
-
No products found
because this supplier's products are not listed.
Thomas Blackwell, et al.,
bioRxiv - Biophysics 2020
Quote:
... Biotin-labeled actin (2 µM) was prepared using 10% biotin actin (Cytoskeleton) in KMg25 buffer ...
-
No products found
because this supplier's products are not listed.
Shamsideen A. Ojelade, et al.,
bioRxiv - Neuroscience 2019
Quote:
... LC column (Phenomenex, Torrance, CA) and SenCell2 electrochemical cell at +450 mV (Antec Leyden ...
-
No products found
because this supplier's products are not listed.
Lisa Miorin, et al.,
bioRxiv - Immunology 2022
Quote:
... sodium pyruvate (Corning), Penicillin/Streptomycin (Corning) ...
-
No products found
because this supplier's products are not listed.
Abigail K. Grosskopf, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Sulfo-NHS (41 mg, 0.19 mmol; Biovision) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC ...
-
No products found
because this supplier's products are not listed.
Guangzhong Ma, et al.,
bioRxiv - Biophysics 2019
Quote:
... Biotin-PEG-NHS (MW = 10 kDa) and streptavidin coated polystyrene particles were purchased from Nanocs. Deionized (DI ...
-
No products found
because this supplier's products are not listed.
Yuhan Wang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... NHS (Tocris, 6420) to amine-modified hairpin oligos from Molecular Instruments ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... and 0.5% biotin-PE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(cap biotinyl)(sodium salt)(Avanti Polar Lipids, Inc.))(by mass) ...
-
No products found
because this supplier's products are not listed.
Cody Gillman, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and labeled with RED-NHS dye (NanoTemper). PTX was prepared in 25 mM HEPES (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Cory M. Nadel, et al.,
bioRxiv - Biochemistry 2023
Quote:
... diluted in LCS buffer (Promega) was added to each well ...
-
No products found
because this supplier's products are not listed.
Ofer Guttman, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and biotin (5597, Cell Signaling). IRE1α lumenal domain ...
-
No products found
because this supplier's products are not listed.
Amy Collins, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Biotin (sc-53179, Santa Cruz), UCHL1 (#3524 ...
-
No products found
because this supplier's products are not listed.
Pierre-Gregoire Coulon, et al.,
bioRxiv - Immunology 2022
Quote:
... Sodium Pyruvate (Lonza), L-Glutamine ...
-
No products found
because this supplier's products are not listed.
Clement Coclet, et al.,
bioRxiv - Microbiology 2023
Quote:
... Sodium acetate (3M sodium acetate ...
-
No products found
because this supplier's products are not listed.
Tomoki Kita, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and then PLL-PEG-biotin (SuSoS) was flowed into the glass chamber ...
-
No products found
because this supplier's products are not listed.
Souza Andrea, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and NHS (N-hydroxysuccinimide) were purchased from Alfa Aesar; MVG GRGDSP (RGD ...
-
No products found
because this supplier's products are not listed.
Lorenzo Marcucci, et al.,
bioRxiv - Biophysics 2021
Quote:
... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
No products found
because this supplier's products are not listed.
L Almeida, et al.,
bioRxiv - Immunology 2019
Quote:
... in 0.1M Sodium Cacodylate (EMS) buffer ...
-
No products found
because this supplier's products are not listed.
Sondos Alhajouj, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Ampicillin Sodium Salt (MP Biomedicals) was added into the medium to the final concentration of 75 μg/ml.