-
No products found
because this supplier's products are not listed.
Anukool A. Bhopatkar, et al.,
bioRxiv - Biophysics 2021
Quote:
... Desalt S-25 (Sorbent Technologies Inc).
-
No products found
because this supplier's products are not listed.
Xianjiang Lan, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... S and C (Helena Laboratories, Beaumont, TX), were utilized as reference isotypes.
-
No products found
because this supplier's products are not listed.
Nathan Pagano, et al.,
bioRxiv - Microbiology 2021
Quote:
... Stratagene and MyGo mini S (Azura Genomics). Additionally ...
-
No products found
because this supplier's products are not listed.
Paulina Kaplonek, et al.,
bioRxiv - Immunology 2021
Quote:
... hCoV-HKU1 spike protein (S) (Immune Tech), SARS-CoV-1 ...
-
No products found
because this supplier's products are not listed.
Liina Hannula, et al.,
bioRxiv - Microbiology 2022
Quote:
... RBD wt (aa 319-541 of the S protein) and S1 wt (aa 14-681 of the S protein) from Medix Biochemica; RBD single mutants K417N ...
-
No products found
because this supplier's products are not listed.
Grace Ying Shyen Goh, et al.,
bioRxiv - Genetics 2022
Quote:
... and PUFAs (mix of fatty acid sodium salts: 150 μM C18:2, S-1127; 150 μM C20:5, S-1144, Nu-Chek Prep). E ...
-
No products found
because this supplier's products are not listed.
Ann-Kathrin Vlacil, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1% P/S in fibronectin (1 µg/mL, Promocell) coated T75 flasks (Sarstedt ...
-
No products found
because this supplier's products are not listed.
Michal Nemergut, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Samples were vortexed (10 s, 2000 rpm, VELP Scientifica), homogenized (4 m/s ...
-
No products found
Shihyoung Kim, et al.,
bioRxiv - Immunology 2022
Quote:
... Anti-murine version of S-CD3e-IT was prepared by conjugating biotinylated-S-CD3e-mAb with streptavidin-ZAP (Advanced Targeting System, San Diego, Calif) in a 1:1 molar ratio as previously described(46).
-
PureCol®-S is a 3 mg/ml, type I bovine atelocollagen solution to use as a collagen standard....
Cat# 5015-20ML,
20 mL, USD $255.0
Ask
Jessie J.-Y. Chang, et al.,
bioRxiv - Immunology 2023
Quote:
... pre-coated with PureCol-S collagen type I (Advanced BioMatrix). The cells were incubated at 37°C and 5% v/v CO2 until confluency in PneumaCultTM-ExPlus media (STEMCELL Technologies ...
-
No products found
because this supplier's products are not listed.
Tomás Dias, et al.,
bioRxiv - Molecular Biology 2022
Quote:
The concentration of customized 200 nm streptavidin GNPs (s-GNPs) (Cytodiagnostics) was determined by NTA ...
-
No products found
because this supplier's products are not listed.
Samuel Okurut, et al.,
bioRxiv - Immunology 2019
Quote:
... and CD21 (Pacific Blue; clone LT21; EXBIO Praha a. s., Czech Republic). CD45 expression was used to discriminate white blood cells in CSF and in blood from Cryptococcus yeast cells ...
-
No products found
because this supplier's products are not listed.
Kimberly L. P. Long, et al.,
bioRxiv - Neuroscience 2021
Quote:
... rabbit anti-glutathione S-transferase π (GSTπ; 1:1000; MBL International, Woburn, MA), sheep anti-carbonic anhydrase II (CAII ...
-
No products found
because this supplier's products are not listed.
Suchitra Kamle, et al.,
bioRxiv - Immunology 2022
Quote:
... The pseudovirus with omicron S protein was obtained from eEnzyme (Gaithersburg, MD, USA). Pseudoviruses containing S protein mutations of COVID variants used in this study can be seen in Supplementary Table S1 ...
-
No products found
Erika Liktor-Busa, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and tittered by qPCR Lentivirus Titration Kit (Applied Biological Materials Inc., LV900-S). bEnd.3 cells were plated in 6-well plates and allowed to adhere overnight ...
-
No products found
because this supplier's products are not listed.
Saber H. Saber, et al.,
bioRxiv - Neuroscience 2024
Quote:
... we diluted anti-GFP Atto647N nanobodies (Synaptic Systems, cat. no. N0301-At647N-S) to final concentration of 100 pM in low K+ or high K+ buffer ...
-
No products found
because this supplier's products are not listed.
Choco Michael Gorospe, et al.,
bioRxiv - Cell Biology 2022
Quote:
... S and G2 phases was performed using FCS Express 7 Flow (De Novo Software). The y-axis scale of the cell cycle histograms was adjusted to fit the highest cell count.
-
No products found
because this supplier's products are not listed.
Rachel C. Clary, et al.,
bioRxiv - Neuroscience 2023
Quote:
... TdTomato fluorescence was collected with a GaAsP photomultiplier tube (Scientifica, S-MDU-PMT-50-65) and green fluorescence was collected with a raw PMT (Scientifica ...
-
No products found
because this supplier's products are not listed.
Thiago J. Borges, et al.,
bioRxiv - Bioengineering 2023
Quote:
... mouse monoclonal anti-human CD8 (Biocare, clone C8/144B), mouse monoclonal anti-human CD31 (Agilent ...
-
No products found
because this supplier's products are not listed.
Jacinta Gahan, et al.,
bioRxiv - Microbiology 2021
Quote:
... Soil can contain up to 60% of its S as sulfate esters (Autry and Fitzgerald 1990) and the quantity of sulfatase enzyme used was calculated on this basis ...
-
No products found
because this supplier's products are not listed.
Diwakar Turaga, et al.,
bioRxiv - Bioengineering 2020
Quote:
Human cardiac fibroblasts (CFs) were purchased from Cell Applications (lot #s 2584 & 3067; San Diego, CA) and cultured according to manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Pavlo Gilchuk, et al.,
bioRxiv - Immunology 2020
Quote:
... RNA transcripts were capped with vaccinia virus capping enzyme using GTP and S-adenosyl-methionine (Aldevron) as substrates to create a cap-0 structure ...
-
No products found
because this supplier's products are not listed.
Rotimi Fasimoye, et al.,
bioRxiv - Cell Biology 2022
Quote:
... This was supplemented with 500 nM isotopically labelled amino acids (Cambridge Isotope Laboratories. Cat# MSK-A2-S).
-
No products found
because this supplier's products are not listed.
Fakhriedzwan Idris, et al.,
bioRxiv - Microbiology 2024
Quote:
... made by conjugating HRP to Mab56.2 using NH2 peroxidase labeling kit (Abnova) and incubated for 1.5 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Safia S. Aljedani, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Excess sample was blotted using a Whatman filter paper and stained for an additional 60 s using Nano-W (Nanoprobes). Excess liquid was blotted off and the grids air-dried for 1-2 minutes ...
-
No products found
because this supplier's products are not listed.
Margarida Beatriz, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Candidate ions with a charge state between +2 and +5 and counts above a minimum threshold of 10 counts per second were isolated for fragmentation and one MS/MS spectrum was collected before adding those ions to the exclusion list for 25 s (mass spectrometer operated by Analyst® TF 1.7, Sciex). The rolling collision was used with a collision energy spread (CES ...
-
No products found
because this supplier's products are not listed.
Martinique Frentrup, et al.,
bioRxiv - Microbiology 2021
Quote:
... manure and soil samples were mixed with 90 g Luria-Bertani broth (Roth) each and subsequently homogenized for 30 s with a bag mixer (Interscience). After sedimentation of coarse particles (30 min ...
-
No products found
because this supplier's products are not listed.
Mengqi Li, et al.,
bioRxiv - Cell Biology 2023
Quote:
... followed by irradiating with UV at a total dose of 35 J/cm2 (exposed within 35 s) on a UV crosslinker (CL-508; UVITEC). The irradiated worms were fed with 1 ml of OP50 bacteria at 1013/ml concentration ...
-
No products found
because this supplier's products are not listed.
Mariève D. Boulanger, et al.,
bioRxiv - Bioengineering 2021
Quote:
... were reacted for 2 h with 150 μL/cm2 of a 3 mg/mL suspension of sulfo-succinimidyl-4-(p-maleimidophenyl)-butyrate (S-SMPB, #BC24, G-Biosciences) in phosphate buffered saline solution (PBS ...
-
No products found
because this supplier's products are not listed.
Yufei Xiang, et al.,
bioRxiv - Bioengineering 2020
Quote:
The RBD (residues 319-541) of the SARS-Cov-2 S protein was expressed as a secreted protein in Spodoptera frugiperda Sf9 cells (Expression Systems) using the Bac-to-bac baculovirus method (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
David B. Kastner, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
No products found
because this supplier's products are not listed.
Raphael D. Teixeira, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 20 % PEG 3350 from condition C8 of PEG/Ion HT crystallization kit (Hampton Research). DgcR_act was crystallised by the same protocol ...
-
No products found
because this supplier's products are not listed.
Zoe L. Watson, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... and 0.5 mM 2’-NH2-ATP (2’-amino-2’-deoxyadenosine-5’-triphosphate, purchased from Axxora). Reactions were incubated at 37 °C for 2 h ...
-
No products found
because this supplier's products are not listed.
Pooja Hoovina Venkatesh, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Cells were pulsed with 450 μCi/35 mm dish of 35 S-labeled methionine and cysteine (American Radiolabeled Chemicals, 1175 Ci/mmol; #ARS0110A) diluted in 2 ml MEM ...
-
No products found
because this supplier's products are not listed.
Lorraine De Jesús-Kim, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the eluate was attached with Sortase to the peptide NH2-GGGHHHHHHHHHHC-COOH coupled to maleimide-Dy649P1 (Dyomics) as described in Ticau et al ...
-
No products found
because this supplier's products are not listed.
Mustafa M. Siddiq, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 1000 ng of total RNA was incubated with ribonuclease R (RNAse R; Biosearch Technologies) following the manufacturer’s instructions for 20 mins at 37 C followed by a cycle of 20 mins at 65 C (30) ...
-
No products found
because this supplier's products are not listed.
Sarah C. Huen, et al.,
bioRxiv - Immunology 2020
Quote:
... FGF21 (R&D and BioVendor), Corticosterone (Enzo) ...
-
Cat# FS10100,
100µL, USD $85.00/100µL
Ask
Saritha S. D’Souza, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 30μl of ViroMag R/L beads (OZ Biosciences) were added and incubated at room temperature for 15 minutes.35 During incubation 3×105 wild-type or CCR5-mut cells were placed in a single well of a 24-well plate and centrifuged at 530g for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Changju Chun, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... QuantumTM R-PE MESF beads (827; Bangs Laboratories) were utilized to produce calibration curves ...
-
No products found
because this supplier's products are not listed.
Bradley M. Roberts, et al.,
bioRxiv - Neuroscience 2020
Quote:
... rabbi anti-NeuN (1:500, Biosensis, R-3770-100); guinea pig anti-S100β (1:2,000 ...
-
No products found
because this supplier's products are not listed.
Raed Ibraheim, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... F/R Primers Plate-96v2 (Pacbio part no. 101-629-100).
-
No products found
because this supplier's products are not listed.
Daisuke Shimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
... using Mouse Mitochondrial DNA Copy Number Assay kit (Detroit R&D, Detroit, MI) for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio ...
-
No products found
because this supplier's products are not listed.
Claudia Kasper, et al.,
bioRxiv - Physiology 2020
Quote:
... Scans were conducted using the ‘total body thick’ mode (0.188 mA, scan speed 80mm/s according to Carver et al., 2013) with enCORE software (version 16) ...
-
No products found
because this supplier's products are not listed.
Sylvie Labrouche-Colomer, et al.,
bioRxiv - Genetics 2020
Quote:
... The concentration of total and free PS antigen were determined by an enzyme-linked immunosorbent assay (Asserachrom total or free protein S; Diagnostica Stago). In normal conditions ...
-
No products found
because this supplier's products are not listed.
Bob J. Ignacio, et al.,
bioRxiv - Cell Biology 2022
Quote:
... bacteria were collected by centrifugation (5,000 g, 3 min). E. coli B834 (a gift from S. van Kasteren, Leiden University) were incubated in SelenoMet medium (Molecular Dimensions) at 37 °C for 30 min to deplete intracellular methionine stores ...
-
No products found
because this supplier's products are not listed.
Yutaka Yamamoto, Susan A. Gerbi,
bioRxiv - Genetics 2022
Quote:
... the females were placed onto 100 mm diameter petri dishes containing 2.2% agar (wt/vol) with 20 µg/ml blasticidin S (A.G. Scientific, Inc), diluted from a stock solution of 10 mg/ml blasticidin in 20 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Irene Pereira de Sousa, et al.,
bioRxiv - Bioengineering 2019
Quote:
... 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-propionic acid succinimidyl ester (BDP FL NHS) fluorescent probe was obtained from Lumiprobe (Hannover, Germany) while APTES was bought from Acros Organics (Basel ...
-
No products found
because this supplier's products are not listed.
Nanami Kikuchi, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... and 2 µl of 1% w/v amine polystyrene fluorescent yellow particles (NH2-beads, Spherotech, Inc) or carboxyl polystyrene fluorescent yellow particles (Spherotech ...
-
No products found
because this supplier's products are not listed.
Pratibha Thakur, et al.,
bioRxiv - Neuroscience 2022
Quote:
... inhibitors used in LSB+X/P/S/D induction included LDN193189 (250 nM; catalog#04-0074, Stemgent, REPROCELL USA Inc., Beltsville, MD, USA), SB431542 (10 μM ...
-
No products found
because this supplier's products are not listed.
Andrew McEwan, et al.,
bioRxiv - Genetics 2020
Quote:
... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...