1 - 50 of 325
suppliers found for
Recombinant Mouse Fcgr1 His & AVI Tagged Biotinylated
» view 10000+ matched products-
Creative Biomart Sponsored
Recombinant Mouse Fcgr1 (NP_034316.1) extracellular domain (Met 1-Pro 297), fused with a...Cat# Fcgr1-2970M, 20.0 µg, USD $299.0 Ask
-
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in Molecular Biology of the Cell doi: 10.1091/mbc.E19-07-0362Quote: Recombinant His-tagged EB1-GFP and His-tagged SEPT5 were transformed into E.coli BL21 (DE3) (Invitrogen). Bacterial cultures were grown to OD600 of 0.6-0.8 and induced with 0.2 mM IPTG for 16 h at 18°C for His-tagged-EB1-GFP or cultures were grown to OD600 of 0.4-0.6 and induced with 1 mM IPTG for 5 h at 23°C for His-tagged SEPT5 ... -
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... was incubated with recombinant His-tagged human HDAC6 protein (EMD Millipore) in 250 μl RB100 buffer (25 mM HEPES pH 7.5 ... -
Sino Biological
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... Biotinylated SARS-CoV-2 full length nucleocapsid (Avi- and His-tagged; Sino Biological, Cat# 40588-V27B-B) was multimerized using streptavidin PE (BioLegend ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in Frontiers in Microbiology doi: 10.3389/fmicb.2019.02328Quote: ... Recombinant His-tagged GAPDH was purified using Ni-NTA Agarose (Qiagen, Valencia, USA) in native conditions according to the manufacturer’s recommendations ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2017, published in Nature Microbiology doi: 10.1038/s41564-018-0203-xQuote: ... Purification of the His-tagged/GST-tagged recombinant proteins was performed as described by the manufacturer (Clontech/GE Healthcare). -
GenScript
No products found because this supplier's products are not listed.Cited in The C. difficile clnRAB operon initiates adaptations to the host environment in response to LL-37bioRxiv - Microbiology 2018, published in PLOS Pathogens doi: 10.1371/journal.ppat.1007153Quote: Recombinant N-terminally His-tagged ClnR was produced by GenScript (Piscataway, NJ). Gene transcription in the clnR mutant complemented with His-tagged ClnR confirmed the functionality of this protein (Table S12) ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2017, published in Nature Microbiology doi: 10.1038/s41564-018-0203-xQuote: ... Purification of the His-tagged/GST-tagged recombinant proteins was performed as described by the manufacturer (Clontech/GE Healthcare). -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in ACS Infectious Diseases doi: 10.1021/acsinfecdis.9b00412Quote: ... BSA (24 - 48 h at 4°C in rotation) for HIS-tagged rPtxS1 and rGαi proteins with mouse monoclonal anti-HIS (1:1000) (R&D Systems, MAB050), for Gαi with mouse monoclonal anti-Gαi (1:500 ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019, published in eLife doi: 10.7554/eLife.47528Quote: His-tagged recombinant soluble CD40L (sCD40L, BioLegend) was incubated with NTA-SUV or plain SUV ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019Quote: ... Biotinylated horse anti-mouse (Vector Laboratories). The cultured tracheas were collected and fixed in 4% paraformaldehyde at 4°C for 1 hour ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... and 6x-HIS-tagged-HOXB2 (Addgene 8522) were obtained from commercial vendors and cloned into pCMV6 vector and transfected into HEK cells ... -
Avidity
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020, published in PLOS ONE doi: 10.1371/journal.pone.0247963Quote: ... Avi-tagged HAs were expressed and purified as described above and biotinylated using the Biotin ligase kit (Avidity) according to the manufacturer’s protocol ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2018Quote: Recombinant mouse TNF was from Peprotech and recombinant mouse IL-3 was from R&D ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019, published in Nucleic Acids Research doi: 10.1093/nar/gkz306Quote: ... 1 μL of 5 μM His-tagged apo-CbAgo was incubated with 1 μL of 1 μg/ml biotinylated anti-6x His antibody (Abcam) for 10 min ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019, published in mAbs doi: 10.1080/19420862.2020.1714371Quote: The recombinant biotinylated A33-His antigen was immobilized on streptavidin (StreptaWells, Roche) or avidin coated wells (Avidin ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.Cited in Anti-HIV-1 B cell responses are dependent on B cell precursor frequency and antigen binding affinitybioRxiv - Immunology 2018, published in Proceedings of the National Academy of Sciences doi: 10.1073/pnas.1803457115Quote: ... Env-specific B cells were stained using Avi-tagged DMRScore-or N276D-gp120 monomers (5 μg/ml) and detected using Streptavidin-PE (BD). Samples were aquired on a BD Fortessa and analyzed using FlowJo software (Treestar). -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2020Quote: ... secondary biotinylated goat anti-mouse antibody (Dako) was added to the slides 1/400 in blocking buffer ... -
Origene Technologies
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in Nature Chemical Biology doi: 10.1038/s41589-019-0304-8Quote: Recombinant Flag-tagged RNF114 was used as bait to precipitate pure recombinant p21 (Origene Technologies Inc. ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2018, published in Nature Communications doi: 10.1038/s41467-018-07251-5Quote: ... His-tagged proteins were immobilized on Ni-NTA (Merck Millipore), washed and eluted in SB buffer (30 mM HEPES-NaOH pH 7.5 ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019Quote: ... were coated to dry overnight at 37°C with 400 ng/well of recombinant His-tagged GT198 proteins together with 5 μg/well of purified BSA (NEB) in a volume of 50 μl ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2018, published in mBio doi: 10.1128/mBio.01006-18Quote: Recombinant His-tagged proteins were resolved by AnykDTM Mini-Protean TGX gels (Bio-Rad) and transferred to nylon-supported nitrocellulose ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2018, published in mBio doi: 10.1128/mBio.01905-18Quote: ... His-tagged proteins were detected with mouse anti-His tag (27E8) antibody at a dilution of 1:1000 (Cell Signaling, Danvers, MA) and an anti-mouse IgG HRP linked antibody at a dilution of 1:2000 (Cell Signaling ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2018Quote: ... His-tagged RanQ69L (4 mM) was preincubated on ice with MagnetHis™ Ni-Particles (Promega) in phosphate binding buffer with 150 mM NaCl and 3 mM β-mercaptoethanol for 30 mins ... -
Jackson ImmunoResearch
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... which was the incubation in biotinylated donkey anti-mouse antibody (1:500, Jackson Immunoresearch) for 4 hours ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2021Quote: ... Primary staining was performed using the mouse anti-His sc-8036 antibody (Santa Cruz Biotech) overnight at 4 °C ... -
Boston Biochem
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2018Quote: Recombinant His-tagged ubiquitin and ubiquitin mutants were purchased from Boston Biochem, dissolved in LFB1/50 (40 mM Hepes/KOH pH 8.0 ... -
Macherey-Nagel GmbH
No products found because this supplier's products are not listed.Cited in Allosteric deregulation of phenylalanine biosynthesis evolved with the emergence of vascular plantsbioRxiv - Plant Biology 2019Quote: ... Poly-His tagged recombinant proteins were purified using a nickel resin (Protino Ni-TED 2000 Packed Columns, Macherey-Nagel) and exchanged to Tris buffer 50 mM pH 8.0 in Sephadex™ G-25 M resin (PD-10 Columns ... -
Miltenyi Biotec
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2021Quote: ... To control for recombinant bacterial MCO expression anti-His-HRP (Miltenyi Biotec) was used (at a dilution of 1:10000 ... -
Proteintech
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2019, published in Journal of Biological Chemistry doi: 10.1074/jbc.RA119.011181Quote: ... His-tagged RmtC proteins were detected by immunoblotting with a rabbit anti-6×His antibody (α6×His; Proteintech; 10001-0-AP) overnight at 4 °C ... -
SouthernBiotech
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2017, published in eLife doi: 10.7554/elife.33947Quote: ... Biotinylated mouse anti-mouse H-2Kd/H-2Dd clone 34-12S was purchased from SouthernBiotech (Birmingham, AL). -
Enzo Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019, published in Nature Structural & Molecular Biology doi: 10.1038/s41594-020-0380-1Quote: ... 20 µM His-tagged ubiquitin (Enzo Life Sciences) in a reaction buffer of 50 mM HEPES pH 7.5 ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Genomics 2019, published in G3: Genes|Genomes|Genetics doi: 10.1534/g3.119.400922Quote: Raw Nanopore and Hi-C (Illumina) reads have been deposited in the NCBI SRA and are under the BioProject (PRJNA565796) ... -
Bioline
No products found because this supplier's products are not listed.bioRxiv - Genetics 2020Quote: ... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ... -
Rockland
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2016, published in Molecular Biology of the Cell doi: 10.1091/mbc.E16-11-0756Quote: ... Fragments tagged with sfGFP were attached similarly using biotinylated anti-GFP IgG (Rockland). -
NanoTemper
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in PLOS Pathogens doi: 10.1371/journal.ppat.1007848Quote: Three independent MST experiments were performed with His-tagged BspC labelled using the Monolith His-Tag Labeling Kit RED-tris-NTA 2nd Generation (NanoTemper Technologies) according to manufacturer’s instructions ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in Molecular and Cellular Biology doi: 10.1128/MCB.00158-19Quote: ... and recombinant mouse M-CSF (Calbiochem) at a final concentration of 10ng/mL for seven days ... -
Mabtech
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2018Quote: ... biotinylated anti-mouse IFN-γ mAb (R4–6A2; Mabtech), followed by ABC peroxidase (Vector Laboratories ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019, published in Proceedings of the National Academy of Sciences doi: 10.1073/pnas.1902537116Quote: ... Samples with the biotinylated probe were incubated for 2 hr in biotinylated donkey anti-mouse secondary antibody (1:500; Jackson Lab) in WB:PBT solution ... -
ChromoTek
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... Ndc80C-7D-GFP and Ndc80C-His were attached to nanobeads using biotinylated anti-GFP nanobody (Chromotek cat No. gtb-250) and biotinylated anti-His antibody (Quiagen cat No ... -
LI-COR
No products found because this supplier's products are not listed.Cited in Secretion of an Argonaute protein by a parasitic nematode and the evolution of its siRNA guidesbioRxiv - Molecular Biology 2019, published in Nucleic Acids Research doi: 10.1093/nar/gkz142Quote: ... Quantification was carried by western blot analysis in comparison to known concentrations of recombinant full length exWAGO containing an N-terminal 3XFlag-His tag using Image Studio Lite (LI-COR) software ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019, published in Journal of Thrombosis and Haemostasis doi: 10.1111/jth.15095Quote: ... 6 ng/mL recombinant mouse IL3 and 10 ng/mL recombinant human IL-6 (all from Stem Cell Technologies). On Day 0 ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... Plant-expressed 6-His tagged ZE3 at 50 ng/well was bound to 96-well high-binding polystyrene plates (Corning Inc, Corning, NY, USA), and the plates were blocked with 5% nonfat dry milk in PBST ... -
Cytoskeleton
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2017, published in eLife doi: 10.7554/elife.32871Quote: ... 10% biotinylated F-actin was prepared by polymerizing G-actin and biotinylated G-actin (Cytoskeleton) in KMEI buffer (50 mM KCl ... -
Cedarlane
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020, published in Cell Host & Microbe doi: 10.1016/j.chom.2020.12.017Quote: ... incubated with biotinylated anti-mouse C1q (Cedarlane #CL7501B ... -
Biovision
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... 100 µl of mouse anti-His-tag antibody (1:1000, BioVision, USA) was incubated at 37□ for 2 h ... -
Phase Genomics
No products found because this supplier's products are not listed.Cited in Emergence of the Ug99 lineage of the wheat stem rust pathogen through somatic hybridisationbioRxiv - Genetics 2019, published in Nature Communications doi: 10.1038/s41467-019-12927-7Quote: A Hi-C library was constructed with the ProxiMeta Hi-C kit from Phase Genomics v 1.0 containing the enzyme Sau3A ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020, published in Nature doi: 10.1038/s41586-020-2280-2Quote: ... Purified hDGAT1 (with his tag) was absorbed onto Copper HIS-Tag PVT beads (Perkin Elmer, RPNQ0095) and incubated with [3H]-Acetyl-CoA (ARC ... -
Abnova
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2018, published in Journal of Cell Biology doi: 10.1083/jcb.201806195Quote: ... diluted 1:1 in PBS for 1 hour at RT and probed with rabbit-His (MBL, 1:1000) and mouse-KBP (Abnova, 1:1000) overnight at 4°C ... -
Genetex
No products found because this supplier's products are not listed.Cited in “Hemicellulose Degradation and Utilization by a Synthetic Saccharomyces cerevisiae Consortium”bioRxiv - Bioengineering 2018Quote: ... were pelleted then re-suspended in 250 μL of PBS containing 1mg/mL bovine serum albumin and 0.5 μg of 1°-Anti-6X His tag mouse antibody (Genetex Inc., CA, USA) for 4 h with occasional mixing ... -
Novus Biologicals
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... and RNF34-HIS (Novus Biologicals) fusion proteins in a total volume of 30μl ...