-
No products found
because this supplier's products are not listed.
Gareth T. Banks, et al.,
bioRxiv - Neuroscience 2020
Quote:
... group housed mice were tagged with RFID micochips at 9 weeks of age and placed in the Home Cage Analysis system (Actual Analytics, Edinburgh) which captured mouse behaviour using both video tracking and location-tracking using RFID co-ordinates.
-
No products found
because this supplier's products are not listed.
Cassidy M.R. Blackburn, et al.,
bioRxiv - Immunology 2020
Quote:
... media was removed and replaced with either D-10 (untreated) or D-10 + 50μg/ml oxidized LDL (hi oxLDL Kalen biomedical 770252-60) for 2 hours ...
-
No products found
because this supplier's products are not listed.
Megan N. Thomas, et al.,
bioRxiv - Microbiology 2023
Quote:
Serum samples collected from the indirect contact pigs at 11 DPC were prepared for the hemagglutination inhibition (HI) assay by receptor-destroying enzyme (RDE II; Hardy Diagnostics, Santa Maria, CA) treatment ...
-
No products found
because this supplier's products are not listed.
Yusha Sun, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... mouse anti-TPH2 (Thomas Scientific, AMAb91108), rabbit anti-TH (Novus Biologicals ...
-
No products found
because this supplier's products are not listed.
Lennard L. Bohlender, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 10 μg of total protein were mixed with one unit of α-L-arabinofuranosidase from either Aspergillus niger or a corresponding recombinant version (E-AFASE or E-ABFCJ, Megazyme, Bray, Ireland) and incubated over night at 40°C ...
-
No products found
because this supplier's products are not listed.
Ying Zhu, et al.,
bioRxiv - Systems Biology 2022
Quote:
... anti-TIMM23 (1:1000, mouse, DB Biotech, 611222). After washing 3 times with TBST ...
-
No products found
because this supplier's products are not listed.
Thomas P. Zwaka, Ronald Richman, Marion Dejosez,
bioRxiv - Neuroscience 2020
Quote:
... mouse monoclonal anti-GAPDH (2-RGM2; Advanced Immunochemical), mouse monoclonal Ronin (Becton Dickinson) ...
-
No products found
because this supplier's products are not listed.
Valentin Greigert, et al.,
bioRxiv - Microbiology 2023
Quote:
... Crypt-a-glo TM (mouse mAb, Waterborne, Inc) was used at 1 drop per transwell ...
-
No products found
because this supplier's products are not listed.
Delphine Planas, et al.,
bioRxiv - Immunology 2021
Quote:
... 2) a CE-Marked ELISA assay for detection of IgG against the full-length recombinant N protein from Epitope Diagnostics (EDITM Novel coronavirus COVID-19 IgG). The test has a specificity of 96% and a sensitivity of 81% after 28 days POS in our hands ...
-
No products found
because this supplier's products are not listed.
Chongkai Zhai, et al.,
bioRxiv - Microbiology 2021
Quote:
... The D-dimer and FDPs concentrations of serum samples were determined by the double antibody sandwich method using mouse D-dimer and mouse FDPs ELISA kits (Sunlong Biotech, Hangzhou, Zhejiang, China) as described previously [44] ...
-
No products found
because this supplier's products are not listed.
Christopher Jonkergouw, et al.,
bioRxiv - Biochemistry 2023
Quote:
... dosed with LPS (50µl/mouse) using a P100 pipette (Gilson). The animals were held upright for a short period of time after dosing to allow for substance distribution down the respiratory tract ...
-
No products found
because this supplier's products are not listed.
Owen J. Chen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and mouse embryonic fibroblasts (MEFs) were cultured using DMEM (Wisent Bioproducts: 4.5 g/L glucose ...
-
No products found
because this supplier's products are not listed.
Chen Jiang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Primary mouse keratinocytes were kept in culture medium (CnT-07; Cellntec) at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Amy L. Kimble, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Frozen mouse and human brain tissues were mechanically homogenized (Next Advance Bullet Blender BB724M with 3.2 mm stainless steel beads using setting 4 for 4min at 4C) ...
-
No products found
because this supplier's products are not listed.
Vaibhav Sidarala, et al.,
bioRxiv - Cell Biology 2022
Quote:
... live mouse islets were exposed to 100 nM Mtphagy dye (Dojindo Molecular Technologies) for 3 hours to assess time-dependent accumulation of mitochondria to acidic organelles by the relative fluorescence intensity of the dye per cell as described 91 ...
-
No products found
because this supplier's products are not listed.
Zhenyue Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... each mouse was administrated the Sulfo-Cyanin-5.5-carboxylic-acid (Lumiprobe GmbH, Germany) fluorescent dye solution in PBS (50 µl ...
-
No products found
because this supplier's products are not listed.
Yijen L. Wu, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... mouse fetuses were secured on a tongue depressor (McKesson Medical-Surgical, Irving, TX) with Webglue surgical adhesive (n-butyl cyanoacrylate ...
-
No products found
because this supplier's products are not listed.
Tumininu S. Faniyan, et al.,
bioRxiv - Physiology 2024
Quote:
... Core body temperature of the mouse was measured using a rectal probe (YSI 4000A Precision Thermometer ...
-
No products found
because this supplier's products are not listed.
Damian L. Trujillo, et al.,
bioRxiv - Immunology 2019
Quote:
Purified mouse-adapted influenza A/PR/8/34 (H1N1) was purchased from Advanced Biotechnologies Inc ...
-
No products found
because this supplier's products are not listed.
Marie O. Pohl, et al.,
bioRxiv - Microbiology 2021
Quote:
... A mouse (#Ab00458-1.1) or rabbit (Ab00458-23.0) anti-dsRNA antibody (9D5; Lucerna-Chem) was used to stain for SARS-CoV-2 infected cells ...
-
No products found
because this supplier's products are not listed.
VP O’Brien, et al.,
bioRxiv - Microbiology 2022
Quote:
... Slides with mouse stomach tissue sections were deparaffinized in Histo-Clear solution (National Diagnostics) and rehydrated with isopropanol ...
-
siRNA to inhibit CPA1 expression using RNA interference
Cat# CRN1044,
15 nmol USD $340.0, 30 nmol USD $510.0
Ask
Yingjuan Liu, et al.,
bioRxiv - Genetics 2020
Quote:
... Secondary antibodies used for IF were goat-anti-mouse H&L FITC (Cohesion Biosciences) or goat-anti-rabbit H&L FITC (Cohesion Biosciences) ...
-
No products found
because this supplier's products are not listed.
Elin Palm, et al.,
bioRxiv - Microbiology 2023
Quote:
... MAB227P Monoclonal antibody to Norovirus (Mouse IgG2a κ, Clone 2002-G5, Maine Biotechnology Services), rabbit anti-Alexa Fluor 488-conjugated polyclonal IgG (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Dara Bree, et al.,
bioRxiv - Neuroscience 2019
Quote:
... a 96-well plate was coated with a mouse anti-CGRP capture antibody (Bertin Bioreagent) and incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Karl A. Johnson, et al.,
bioRxiv - Biophysics 2020
Quote:
... we imaged a GFP labelled mouse brain sample acquired from SunJin Lab (Hsinchu City, Taiwan). This sample is a 250um thick coronal section which was cleared and mounted by SunJin Lab using the RapiClear 1.52 reagent.
-
No products found
because this supplier's products are not listed.
Jian Cui, et al.,
bioRxiv - Immunology 2023
Quote:
... 25 μL of HBSA containing 10 nM mouse FVIIa (Enzyme Research Laboratories, South Bend, IN), 300 nM human FX (Enzyme Research Laboratories ...
-
No products found
because this supplier's products are not listed.
Samuel X. Shi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Brain slices (2 mm) were consecutively sectioned coronally using a stainless-steel mouse brain matrix (Roboz Surgical Instrument Co. ...
-
No products found
because this supplier's products are not listed.
Ritu Bohat, et al.,
bioRxiv - Immunology 2023
Quote:
Experimental mice were individually housed in mouse metabolic cages (#MM030505-10R, Lenderking caging products, Millersville, MD) for 24 hours to collect urine samples ...
-
No products found
because this supplier's products are not listed.
Machmouchi Dana, et al.,
bioRxiv - Microbiology 2024
Quote:
... ZIKV infectivity was assessed using the mouse anti-E protein mAb 4G2 (RD-Biotech, Besançon, France). Antibody donkey anti-mouse Alexa Fluor 488 IgG (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Kristina D. Micheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A 10 nm gold-labeled goat anti-mouse IgG secondary Ab (SPI Supplies, West Chester, PA) was used at 1:25 for 1 hr ...
-
No products found
because this supplier's products are not listed.
Julie Wells, et al.,
bioRxiv - Molecular Biology 2022
Quote:
The left lung lobe of each mouse was fixed in neutral buffered formalin (Labchem, Inc. Pittsburgh, PA) overnight at room temperature ...
-
No products found
because this supplier's products are not listed.
Cathrin LC Gudd, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... incubated with diluted mouse serum (1:8 or 1:16 dilution) and biotinylated detection antibodies (mAB2:1, UmanDiagnostics). Upon adding streptavidin-conjugated β-galactosidase (Quanterix) ...
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
No products found
Jelena Perovanovic, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Mouse ESCs were cultured as previously described (46) with 2i conditions: ERK inhibitor PD0325901 (1 μM, LC Laboratories) and GSK3 inhibitor CHIR99021 (3 μM ...
-
No products found
because this supplier's products are not listed.
Henriette Frikke-Schmidt, et al.,
bioRxiv - Physiology 2020
Quote:
The heating pad with the mouse was then placed on top of the H101A ProScan motorized stage (Prior Scientific Instruments Ltd ...
-
No products found
because this supplier's products are not listed.
Dyah W. Karjosukarso, et al.,
bioRxiv - Systems Biology 2023
Quote:
... pH 7.4), followed by secondary antibody anti-mouse IRDye 800 (1:4000, LiCor Biosciences) and DR (1:4000, Biostatus) for 1 hour at RT ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Ainhoa Martínez-Pizarro, et al.,
bioRxiv - Pathology 2023
Quote:
... cDNA was obtained by retrotranscription of 500 ng of total RNA from mouse liver or HepG2 cells using NZY First-Strand cDNA synthesis kit (NZYTech). Pah ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Yuka Takemon, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Mice were fully genotyped for 78,000 SNPs using the GeneSeek Mega Mouse Universal Genotyping Array (MegaMUGA) (Neogen Genomics, Lincon, NE, USA) [43] ...
-
No products found
because this supplier's products are not listed.
Jared D. Chrispell, Yubin Xiong, Ellen R. Weiss,
bioRxiv - Cell Biology 2022
Quote:
... Rabbit polyclonal antibodies against zebrafish Grk7 (27) and phosphorylated mouse Grk1 (17) were generated by 21st Century Biochemicals (Marlboro, MA, USA). A novel rabbit polyclonal antibody against phosphorylated zebrafish GRK1 was also generated by 21st Century Biochemicals using the peptide ISARG[pS]FDGTAN corresponding to amino acids 16-27 of zebrafish Grk1a ...
-
No products found
because this supplier's products are not listed.
Mathew Clement, et al.,
bioRxiv - Immunology 2020
Quote:
The α and β chains of the MEL5 TCR were engineered to contain mouse constant domains [20] and cloned into a single pSF-Lenti-EF1α lentiviral vector (Oxford Genetics) separated by an internal ribosomal entry site (IRES ...
-
No products found
because this supplier's products are not listed.
Jia J. Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 20-24 mice whose tumor volume had reached ∼250 mm3 (mouse grafts) or ∼80 mm3 (human grafts) at week two after grafting received either 10 mg/kg enzalutamide (TargetMol T6002) or 0.5% DMSO (MilliporeSigma D2650 ...
-
No products found
because this supplier's products are not listed.
Kaushik Bhattacharya, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Lysates of cells or mouse tissues (20-100 μg) were subjected to SDS-PAGE and transferred onto a nitrocellulose membrane (GVS Life Science) with a wet blot transfer system (VWR) ...
-
No products found
Sahil Shah, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Then the promoter activities were tested in C20 human microglia and SIM-A9 mouse microglia cell lines using Glial-Mag kit (OZ Bioscience, Cat # GL002500). The cells were cultured under standard conditions and seeded into 96-well plates at a density of 3.0×104/100 μl ...
-
No products found
because this supplier's products are not listed.
B. van de Kooij, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... was used for MDA-MB-436 and mouse targeting shEXO1 (see Table 1 for sequence, cloned in pRSITEP-U6Tet-sh-EF1-TetRep-2A-Puro from Cellecta Catalog #: SVSHU6T16-L) was used for MEFs.
-
No products found
because this supplier's products are not listed.
Marcos Moreno-Aguilera, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... More than 90 million reads were obtained per sample, which were aligned to the mm10 mouse genome using HISAT2 (Kim et al, 2015) in the Galaxy platform (Boekel et al, 2015). Assignment to transcriptional units ...
-
No products found
because this supplier's products are not listed.
Hanah M. Georges, et al.,
bioRxiv - Immunology 2023
Quote:
Human and mouse FMs were homogenized using a beadbug microtube homogenizer with microtubes pre-filled with high impact zirconium beads (Benchmark Scientific; Sayreville, NJ) as previously described (6) ...
-
No products found
because this supplier's products are not listed.
Erica L. Stone, et al.,
bioRxiv - Immunology 2021
Quote:
... blocks were cut in 5 μm sections that were placed on glass slides for anti-IgG (UltraPolymer Goat anti-Mouse heavy and light chain IgG-HRP, Cell IDx, San Diego, CA, USA) or anti-C3 (EPR19394 ...