-
No products found
because this supplier's products are not listed.
Nuno Apóstolo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1 µg recombinant His-tagged mouse IgSF8 (Sino Biological) was incubated in 1 ml binding buffer (10 mM HEPES pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Daniele Tedesco, et al.,
bioRxiv - Biophysics 2021
Quote:
... 6×His-tagged recombinant MSP1E3D1 (Sigma-Aldrich, Merck, USA) and FLAG-tagged recombinant mCardinal (kindly provided by Jakub Czapiński ...
-
No products found
because this supplier's products are not listed.
Konstantinos Nakos, et al.,
bioRxiv - Cell Biology 2019
Quote:
Recombinant His-tagged EB1-GFP and His-tagged SEPT5 were transformed into E.coli BL21 (DE3) (Invitrogen). Bacterial cultures were grown to OD600 of 0.6-0.8 and induced with 0.2 mM IPTG for 16 h at 18°C for His-tagged-EB1-GFP or cultures were grown to OD600 of 0.4-0.6 and induced with 1 mM IPTG for 5 h at 23°C for His-tagged SEPT5 ...
-
No products found
because this supplier's products are not listed.
Raja Veerapandian, Govindsamy Vediyappan,
bioRxiv - Microbiology 2019
Quote:
... Recombinant His-tagged GAPDH was purified using Ni-NTA Agarose (Qiagen, Valencia, USA) in native conditions according to the manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Joy S. Xiang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Recombinant His-tagged NSP12 (R&D Systems, catalog # 10686-CV) was incubated with in vitro transcribed and biotinylated RNA in 20 mM Tris ...
-
No products found
because this supplier's products are not listed.
Joanne Durgan, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Recombinant His-tagged human ATG4B (Abcam, ab188707) was pre-treated with 10 mM DTT for 15 mins ...
-
No products found
because this supplier's products are not listed.
Li Chang, et al.,
bioRxiv - Plant Biology 2019
Quote:
... His-tagged recombinant protein was purified by TALON Superflow (GE Healthcare Life Sciences, Pittsburgh, PA, USA) according to the manufacturer’s description ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... His-tagged recombinant proteins were isolated by 1 h incubation with Talon metal affinity resin (Clontech) at room temperature ...
-
No products found
because this supplier's products are not listed.
David G. Saliba, et al.,
bioRxiv - Immunology 2019
Quote:
His-tagged recombinant soluble CD40L (sCD40L, BioLegend) was incubated with NTA-SUV or plain SUV ...
-
No products found
because this supplier's products are not listed.
Mason Minot, Sai T. Reddy,
bioRxiv - Bioengineering 2023
Quote:
HIS-tagged HER2 (Addgene #16257) was expressed using the Expi293™ expression system (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Thomas K. Sawyer, et al.,
bioRxiv - Biochemistry 2024
Quote:
... His-tagged Enterokinase (Z03004, Genscript) was added to the dialyzed ...
-
No products found
because this supplier's products are not listed.
Tatiana P. Soares da Costa, et al.,
bioRxiv - Microbiology 2022
Quote:
... Recombinant His-tagged proteins were purified using a 5 mL IMAC column (Bio-Rad Laboratories ...
-
No products found
because this supplier's products are not listed.
Sieglinde De Cae, et al.,
bioRxiv - Microbiology 2023
Quote:
... His-tagged recombinant human FcRn (FCGRT-B2M heterodimer) protein was purchased from ACROBiosystems. Bebtelovimab biosimilar and a human IgG1 isotype control antibody were used as controls in the assay ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593 ...
-
No products found
because this supplier's products are not listed.
Daniele Tedesco, et al.,
bioRxiv - Biophysics 2021
Quote:
... 6×His-tagged recombinant MSP1E3D1 (Sigma-Aldrich, Merck, USA) and FLAG-tagged recombinant mCardinal (kindly provided by Jakub Czapiński ...
-
No products found
because this supplier's products are not listed.
Adel Avetisyan, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... His-tagged proteins in soluble fraction were purified using cOmplete His-Tag Purification Columns (Roche). The columns were washed with 10 column volumes of wash buffer 1 (20 mM Tris ...
-
No products found
because this supplier's products are not listed.
Claude Gregoire, et al.,
bioRxiv - Immunology 2021
Quote:
... Mouse recombinant IL-21 (PeproTech) was added to co-cultures at 10ng/ml ...
-
No products found
because this supplier's products are not listed.
Nilabhra Mitra, Sanghamitra Dey,
bioRxiv - Plant Biology 2021
Quote:
Ni pull down experiments were performed using 3μl of His tagged OsSRT1 constructs (0.3μg/ul) and 1μg recombinant human Histone H3 (NEB) and mixed with 20 μl of Ni-NTA slurry (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Tianhu Sun, et al.,
bioRxiv - Plant Biology 2022
Quote:
... His-tagged and GST-tagged recombinant proteins were purified using Promega MagneHis™ Ni-Particles (Promega Cat#V854A) and MagneGST™ Glutathione Particles (Promega Cat# V861A ...
-
No products found
because this supplier's products are not listed.
Mitro Miihkinen, et al.,
bioRxiv - Cell Biology 2021
Quote:
Recombinant His-tagged proteins were labeled using the Monolith His-Tag Labeling Kit RED-tris-NTA (NanoTemper, MO-L008). In all experiments ...
-
No products found
because this supplier's products are not listed.
Wei Kong, et al.,
bioRxiv - Plant Biology 2021
Quote:
... His-tagged proteins were detected by a mouse anti-His antibody (sc-8036, 1:3000, Santa Cruz Biotechnology). GST-tagged proteins were detected by a mouse anti-GST antibody (sc-138 ...
-
No products found
because this supplier's products are not listed.
Marco Di Gioia, et al.,
bioRxiv - Immunology 2023
Quote:
... His-tagged recombinant human AKT1 (BPS Bioscience, Cat# 40003), AKT2 (BPS Bioscience ...
-
No products found
because this supplier's products are not listed.
Stefania Capone, et al.,
bioRxiv - Immunology 2020
Quote:
... recombinant human His-tagged ACE-2 protein (RayBiotech) was incubated on cells before adding any antibodies ...
-
No products found
because this supplier's products are not listed.
Jorge El-Azaz, et al.,
bioRxiv - Plant Biology 2019
Quote:
... Poly-His tagged recombinant proteins were purified using a nickel resin (Protino Ni-TED 2000 Packed Columns, Macherey-Nagel) and exchanged to Tris buffer 50 mM pH 8.0 in Sephadex™ G-25 M resin (PD-10 Columns ...
-
No products found
because this supplier's products are not listed.
Meisam Nosrati, et al.,
bioRxiv - Biochemistry 2019
Quote:
... His-tagged RmtC proteins were detected by immunoblotting with a rabbit anti-6×His antibody (α6×His; Proteintech; 10001-0-AP) overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Zeynep Tarcan, et al.,
bioRxiv - Biochemistry 2021
Quote:
Recombinant His-tagged ubiquitin and ubiquitin mutants were purchased from Boston Biochem, dissolved in LFB1/50 buffer (10% sucrose ...
-
No products found
because this supplier's products are not listed.
Brian L. Hie, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... His-tagged antigens using Anti-Penta-HIS biosensors (Sartorius/ForteBio). Antigen was loaded to a threshold of 1 nm shift ...
-
No products found
because this supplier's products are not listed.
Xuanwen Li, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Recombinant mouse HEXB protein (His Tag) was obtained from MyBioSource (San Diego, CA). Recombinant proteins alcohol dehydrogenase (ADH ...
-
No products found
because this supplier's products are not listed.
Ryotaro Tojima, et al.,
bioRxiv - Immunology 2024
Quote:
... and recombinant mouse TGF-β (5231, Cell Signaling Technology) were purchased from the indicated sources.
-
No products found
because this supplier's products are not listed.
Nur F. Isa, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... His-tagged recombinant proteins were retained on nickel magnetic beads (VWR International) and GST-tagged recombinant proteins were retained on glutathione magnetic beads (Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Shun Watanabe, et al.,
bioRxiv - Biochemistry 2023
Quote:
The pET-30a-PHB1 vector encoding His-tagged mouse PHB1 was transformed into Escherichia coli strain BL21 Star (DE3; Stratagene). The resulting N-terminal His-tagged recombinant PHB1 was purified using Ni-Sepharose 6 Fast Flow (GE Healthcare) ...
-
No products found
because this supplier's products are not listed.
Cansu Yildirim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... recombinant mouse IFNγ (Immunotools, #12343537), recombinant mouse IL4 (Immunotools ...
-
No products found
because this supplier's products are not listed.
Chien-Wei Wang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Recombinant His-tagged streptavidin (Fitzgerald Industries, Acton, MA) at a concentration of 0.75 μM was used as a negative control molecule ...
-
No products found
because this supplier's products are not listed.
Tania Christova, et al.,
bioRxiv - Neuroscience 2023
Quote:
Recombinant GST-tagged LTK (SignalChem #L11-11G) was incubated in the absence or in the presence of an equal amount of recombinant His-tagged IGF-1R (SignalChem #I02-11H ...
-
No products found
because this supplier's products are not listed.
Dongun Lee, Dong Min Shin, Jeong Hee Hong,
bioRxiv - Molecular Biology 2022
Quote:
... which was detected by incubation with fluorescein isothiocyanate-tagged anti-mouse IgG antibody (green, 1:200) and rhodamine-tagged anti-mouse IgG antibody (red, 1:200) (Jackson ImmunoResearch, West Grove ...
-
No products found
because this supplier's products are not listed.
Pablo Alcón, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... 20 µM His-tagged ubiquitin (Enzo Life Sciences) in a reaction buffer of 50 mM HEPES pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Chang-Hoon Kim, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Recombinant Flag-tagged human G9a (Active Motif, 31410), human calpain 1 (Novus ...
-
No products found
because this supplier's products are not listed.
Christin Naumann, et al.,
bioRxiv - Plant Biology 2021
Quote:
... To control for recombinant bacterial MCO expression anti-His-HRP (Miltenyi Biotec) was used (at a dilution of 1:10000 ...
-
No products found
because this supplier's products are not listed.
U Sarma, et al.,
bioRxiv - Systems Biology 2019
Quote:
... Soluble mouse recombinant IL10 and IFNγ were procured from BD Biosciences (San Diego ...
-
No products found
because this supplier's products are not listed.
Priyabrata Mohanty, et al.,
bioRxiv - Microbiology 2021
Quote:
... 50 μL mouse monoclonal anti-6X His tagged primary antibody (Calbiochem) was added at a dilution of 1:150 in 0.5 % BSA in PBST in the respective wells and incubated for 2 hours without shaking at room temperature ...
-
Recombinant Mouse Hpx (NP_059067.2) full length (Met 1-Gln 460), fused with a polyhistidine tag...
Cat# Hpx-3282M,
50ug , USD $429
Ask
Kincaid Rowbotham, Jacob Haugen, Barry Milavetz,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.25 μg of HIS-tagged SP1 (Creative BioMart) for 30 minutes at 40 with constant rotation ...
-
No products found
because this supplier's products are not listed.
Melissa Castiglione, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... 6 ng/mL recombinant mouse IL3 and 10 ng/mL recombinant human IL-6 (all from Stem Cell Technologies). On Day 0 ...
-
No products found
because this supplier's products are not listed.
Jun-Gu Kang, et al.,
bioRxiv - Microbiology 2019
Quote:
... His-tagged Gn and Gc recombinant proteins were purchased from Immune Technology Co ...
-
No products found
because this supplier's products are not listed.
D. Azimova, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse anti-His (ABclonal AE003).
-
No products found
because this supplier's products are not listed.
Darrell Pilling, et al.,
bioRxiv - Immunology 2022
Quote:
... and c-Myc–tagged recombinant mouse NEU3 was purified using a Myc-Trap agarose kit (ytak-20; Chromotek, Hauppauge, NY) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Jasmina Damnjanović, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Recombinant Mouse Transglutaminase 2 was from Novus Biologicals, USA ...
-
No products found
because this supplier's products are not listed.
Sindelka Radek, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... size selected and tagged by Illumina sequencing adapters ...
-
No products found
because this supplier's products are not listed.
Emily A. Rex, et al.,
bioRxiv - Microbiology 2023
Quote:
His-tagged SSRP1 was PCR amplified from SSRP1 pReceiver (GeneCopoeia) using primers encoding an N-terminal His tag and NdeI/NotI cut sites for cloning into pET22b ...
-
No products found
because this supplier's products are not listed.
Alexandra Papaioannou, et al.,
bioRxiv - Biochemistry 2022
Quote:
... from Carna Biosciences as the tyrosine kinase and 1 μg of human recombinant GST-tagged RtcB (GST-C22orf28: 81.6 kDa) (P01) from Abnova as the substrate ...
-
No products found
because this supplier's products are not listed.
Feng Li, et al.,
bioRxiv - Genetics 2019
Quote:
A Hi-C library was constructed with the ProxiMeta Hi-C kit from Phase Genomics v 1.0 containing the enzyme Sau3A ...