-
No products found
because this supplier's products are not listed.
Xiaohui Zhao, et al.,
bioRxiv - Biochemistry 2021
Quote:
... pyridoxal-5’-phosphate (Oakwood Chemical, Catalog #044568), azido-PEG3-biotin (Click Chemistry Tools ...
-
Cat# AP0050,
50 ML, USD $101.00/50mL
Ask
Amanda K. Hund, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... 3) 10ul of Alum (2% Alumax Phosphate, OZ Bioscience) + 10ul PBS (alum treatment) ...
-
No products found
because this supplier's products are not listed.
Guillermo García-Marquina, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 0.2 µM the immobilized or solution form of SNAP-tagged FCE was incubated with 0.5 µM of a 5′ triphosphate 3′ FAM-labeled RNA oligonucleotide (ppp25-mer; Bio-synthesis Inc.) in reactions containing 50 mM Tris-HCl (pH 8.0) ...
-
No products found
because this supplier's products are not listed.
Shaun M. Christie, et al.,
bioRxiv - Biophysics 2021
Quote:
... Recombinant human Semaphorin 3A (CX65, Bon Opus Biosciences, Milburn, NJ) contains residues 21-771 and is >95% pure ...
-
No products found
because this supplier's products are not listed.
Xiaowei Sun, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Recombinant human insulin (M9194) was purchased from AbMole (Houston, USA). The ARF1 inhibitor Golgicide A (HY-100540 ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB) (Primerdesign Ltd), using the delta-CT or delta-delta Ct method[38].
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
Ribulose-5-Phosphate-3-Epimerase Antibody is a Rabbit Polyclonal antibody against...
Cat# abx115282-100UL,
100 µl USD $710.5
Ask
Isabel Brandão, et al.,
bioRxiv - Physiology 2023
Quote:
... or after the primary antibody was incubated with recombinant Human Peroxidasin Homolog Protein (Abbexa; catalog # abx068474), in equimolar (1:1 ...
-
No products found
because this supplier's products are not listed.
Tianyang Mao, et al.,
bioRxiv - Immunology 2021
Quote:
The triphosphorylated RNA oligonucleotides SLR-14 (5′ pppGGAUCGAUCGAUCGUUCGCGAUCGAUCGAUCC-3′ and SLR-14-amino (5′ pppGGAUCGAUCGAUCGUXCGCGAUCGAUCGAUCC-3′ where X = aminomodifier C6dT; Glen Research) were prepared as described57 ...
-
No products found
because this supplier's products are not listed.
Maria E. Candela, et al.,
bioRxiv - Immunology 2021
Quote:
Treatments with HBD3 peptide(s) was after 15-30 minutes 5 μg/ml of human β-Defensin-3 (hBD3) (Peptide Institute Inc., PeptaNova GmbH #4382-s), or 5 μg/ml of Linear Defensin (Almac Sciences Scotland Ltd ...
-
No products found
because this supplier's products are not listed.
Joshua Hutchings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3 μL of BSA-blocked 5 nm gold nanoparticles (BBI Solutions) were added to a 30 μL GUV BR and gently agitated just prior to vitrification ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
F Abou Azar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... were isolated from wildtype mice or transgenic mice over-expressing a TAP-tagged 14-3-3ζ that were fed a low-fat (LFD) or 60% high-fat diet (HFD; Research Diets, New Brunswick, NJ) for 12 weeks (24) ...
-
No products found
because this supplier's products are not listed.
Omar Al Rifai, et al.,
bioRxiv - Physiology 2021
Quote:
... urine was collected in the morning for 3 consecutive days and phosphate level was normalized to creatinine measured using creatinine assay (Quidel, cat#: 8009).
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H5,
1.0 ea, USD $1915.0
Ask
Nina Kessler, et al.,
bioRxiv - Immunology 2022
Quote:
cGAMP in human PBMCs was quantified with the 2’,3’-Cyclic GAMP ELISA Kit (Arbor assays) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Yuan Tian, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 0.5 M ammonium phosphate (Hampton Research) at 16 °C ...
-
No products found
because this supplier's products are not listed.
Xian Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... Human B cell proliferation was measured by 3[H]-thymidine incorporation (1 μCi/mL) (American Radiolabeled Chemicals).
-
No products found
because this supplier's products are not listed.
Matthew J. Winans, et al.,
bioRxiv - Microbiology 2019
Quote:
... Butterfield phosphate buffer obtained from Hardy Diagnostics, USA ...
-
No products found
because this supplier's products are not listed.
Emily Lorenzen, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Phosphate buffered saline (PBS) was from Medicago. ProClin 300 ...
-
No products found
because this supplier's products are not listed.
F. Phil Brooks III, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a stack of one 5 mm and two 3 mm round cover glass (Thomas Scientific, 1217N66), pre-glued by optical glue (Norland 61) ...
-
No products found
because this supplier's products are not listed.
William S. Lawrence, et al.,
bioRxiv - Microbiology 2023
Quote:
... Biotinylated recombinant PA83 (List Biological Labs, Campbell, CA) was bound to streptavidin-coated plates (MesoScale Discovery ...
-
Phosphate Buffered Saline (PBS) 10X is formulated and prepared to use in conjunction with other...
Cat# 5076-100ML,
100 mL, USD $65.0
Ask
Xiangda Zhou, et al.,
bioRxiv - Biophysics 2021
Quote:
... FibriCol Type I Collagen Solution (bovine, 10 mg/ml) and VitroCol Type I Collagen Solution (Human, 3 mg/ml) were obtained from Advanced BioMatrix.
-
WB, IHC, IF,ELISA
Cat# A5439, SKU# A5439-20ul,
20ul, $47.00
Ask
Xuxiao He, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and Nickel Magnetic Beads for His tag protein purification (Bimake, B23602) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
M. Kyle Cromer, et al.,
bioRxiv - Genetics 2021
Quote:
... The sgRNA modifications added were the 2’-O-methyl-3’-phosphorothioate at the three terminal nucleotides of the 5’ and 3’ ends described previously38. All Cas9 protein (SpyFi S.p. Cas9 nuclease) was purchased from Aldevron, LLC (Fargo ...
-
No products found
because this supplier's products are not listed.
Kenji Shimada, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... then 0.002 U of recombinant hOGG1 (Trevigen, 4130-100-E) was added to one sample and further incubated for 30 min at 37°C ...
-
No products found
because this supplier's products are not listed.
Wenli Yang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 8-(4-Chlorophenylthio)-2’-O- methyladenosine-3’,5’-cyclic monophosphate acetoxymethyl ester (007-AM) was from Axxora (Cat. # BLG-C051). DAPI (Cat ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... which were diluted 1:100 in triplicate into 5 mL fresh CHG media containing either 100 μM of the corresponding substrate (either LCA [Sigma] or 3-oxoLCA [Steraloids]). Cultures were grown for 48 hours at 37 °C ...
-
No products found
because this supplier's products are not listed.
Sylvie Roy, et al.,
bioRxiv - Microbiology 2020
Quote:
... Serial dilutions of known amounts of C-terminally Fc-tagged S2 (BioVendor, Brno, Czech Republic) were used for quantification.
-
No products found
because this supplier's products are not listed.
Rui Cheng, et al.,
bioRxiv - Biochemistry 2020
Quote:
ATPase activity was quantified using PiColorLock™ phosphate detection system kit (Expedeon) that monitored the amount of free phosphate released ...
-
No products found
because this supplier's products are not listed.
Donna Ye, et al.,
bioRxiv - Microbiology 2019
Quote:
... Overnight cultures of strains in either Typticase Soy Broth (Difco) or R2B (3-5 mls) were grown at 25°C in a rotating rack (Cole-Parmer). Sterile broth (75-100µl ...
-
No products found
because this supplier's products are not listed.
Jennifer G. Abelin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Peptides were reconstituted in 3% ACN/5% FA prior to loading onto an analytical column (35 cm, 1.9µm C18 (Dr. Maisch HPLC GmbH), packed in-house PicoFrit 75 µm inner diameter ...
-
No products found
because this supplier's products are not listed.
Gopinath Chattopadhyay, et al.,
bioRxiv - Biophysics 2022
Quote:
... The eluted fractions were pooled and dialysed thrice using a 3-5 kDa (MWCO) dialysis membrane (40mm flat width) (Spectrum Labs) against 1X PBS ...
-
No products found
because this supplier's products are not listed.
Alan Wanke, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and laminaripentaose β-1-3-(Glc)5 at a concentration of 1.5 mg·mL−1 were used as standards (Megazyme, Bray, Ireland). To visualize the glucan fragments ...
-
No products found
because this supplier's products are not listed.
Huan Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... The recombinant vectors were transiently transfected into HEK293F cells with polyethyleneimine (Polyscience). After three days of expression ...
-
No products found
because this supplier's products are not listed.
Ryan M. Glanz, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a pup with a visible milk band was removed from the litter and anesthetized with isoflurane gas (3–5%; Phoenix Pharmaceuticals, Burlingame, CA). A custom-made bipolar hook electrode (0.002-inch diameter ...
-
No products found
because this supplier's products are not listed.
Patrice Delaney, et al.,
bioRxiv - Genetics 2023
Quote:
... Fisher Scientific; 1327-53-3), As(V) (Arsenic V Speciation Standard, Fisher Scientfic; 7732-18-5, AsB (Arsenobetaine Standard Solution, LGC Standards; NIST-3033), DMA (Dimethylarsinic Acid Standard Solution ...
-
No products found
because this supplier's products are not listed.
Ok-Hee Kim, et al.,
bioRxiv - Physiology 2019
Quote:
... and human intact FGF23 (Elabscience) were measured using enzyme-linked immunosorbent assay ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Feng Long, et al.,
bioRxiv - Genomics 2020
Quote:
... SMOC2 EC domain and Mut SMOC2 EC domain containing the His tag were synthesized by Bioss Biotechnology ...
-
No products found
because this supplier's products are not listed.
Damian Dudka, R. Brian Akins, Michael A. Lampson,
bioRxiv - Cell Biology 2023
Quote:
... Centromeres were labeled with CREST (human anti-human Anti-Centromere Antibody, 1:200, Immunovision, HCT-0100) and an Alexa Fluor 594–conjugated goat anti-human secondary antibody (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Sherine E. Thomas, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Wizard 3&4 (Molecular Dimensions), JCSG +Suite (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Matthew D. J. Dicks, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Human coagulation Factor X (hFX) (Haematologic Technologies) was added to diluted vectors at a final concentration of 8 μg/mL ...
-
No products found
because this supplier's products are not listed.
Maciej Kliszczak, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-human FAM111B (HPA038637, Atlas Antibodies) at 1:1000 (IB and IF) ...
-
No products found
because this supplier's products are not listed.
Charlotte A. Stoneham, et al.,
bioRxiv - Microbiology 2021
Quote:
... were washed with 1X phosphate-buffered saline (PBS) and resuspended using Acutase dissociation media (Innovative Cell Technologies). The cells were collected and pelleted by centrifugation at 300 x g for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Nicholas B. Karabin, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Pooled human plasma was acquired from Zen-Bio Inc ...
-
No products found
because this supplier's products are not listed.
Adeeba H. Dhalech, et al.,
bioRxiv - Microbiology 2022
Quote:
... and pancreas were aseptically collected 3 dpi and homogenized in phosphate-buffered saline using 0.9-2.0 mm stainless steel beads in a Bullet Blender (Next Advance). Cellular debris was removed by centrifugation at 12,000xg for 10 min at 4°C ...
-
No products found
because this supplier's products are not listed.
Robin Hoeven, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Lysate samples were analysed for recombinant protein expression by SDS PAGE (12% Mini-PROTEAN-TGX stain-free gel; Bio-Rad), using Precision Plus unstained protein ladder (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Andrew N. Stewart, et al.,
bioRxiv - Neuroscience 2023
Quote:
Serotonin (5-HT) positive axons were identified using chromogen labeling against 5-HT (1:4000; 20080; ImmunoStar) and were either not co-labeled in the first acute experiment ...
-
No products found
because this supplier's products are not listed.
Jacob W. Myerson, et al.,
bioRxiv - Bioengineering 2020
Quote:
... with separate compartments for each mouse (MPC-3 AERO; Braintree Scientific). To maintain adequate hydration ...