-
No products found
because this supplier's products are not listed.
Ghulam Destgeer, et al.,
bioRxiv - Bioengineering 2020
Quote:
... particles were incubated with varying concentrations of human recombinant NT-proBNP (HyTest, Finland) for 1 hr with subsequent washing ...
-
No products found
because this supplier's products are not listed.
Marc Sunden, et al.,
bioRxiv - Biochemistry 2023
Quote:
A peptide (NH2-KKKYPGGSTPVSSANMM-COOH) containing an O-GlcNAcylation site of human Casein kinase II subunit alpha (underlined sequence) was custom synthesized by Nordic BioSite. A mixture of 6 mM glutaraldehyde ...
-
No products found
because this supplier's products are not listed.
Zane Kliesmete, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... Primary antibodies (chicken alpha-GFP, Aves Labs: GFP-1010 and rabbit alpha-Ki67 ...
-
No products found
because this supplier's products are not listed.
Linyuan Shi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The GABAA receptor positive allosteric modulator indiplon (AdooQ Biosciences) or the GSK3β inhibitor AR-A104418 (AdooQ Biosciences ...
-
No products found
because this supplier's products are not listed.
Kelly L. Buchanan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or the sweet taste receptor inhibitor (T1R2/3) gurmarin (Peptides International) were dissolved into 1M sucrose ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
Recombinant mouse TNFSF11 (IBI Scientific, Indiana), also known as RANKL ...
-
No products found
because this supplier's products are not listed.
Nathan Hodson, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and visualized using a Fluorochem E Imaging system (Protein Simple; Alpha Innotech, Santa Clara, CA). Bands were quantified using Protein Simple AlphaView SA software and normalized to Ponceau S and a gel control (identical generic sample run on every gel).
-
No products found
because this supplier's products are not listed.
Quynh T. Phan, et al.,
bioRxiv - Microbiology 2021
Quote:
... approximately 2×107 fungal cells were incubated with human kininogen (10 μg/ml; Molecular Innovations, Inc., Cat. # HK-TC) and/or human vitronectin (30 μg/ml ...
-
No products found
because this supplier's products are not listed.
Delphine Planas, et al.,
bioRxiv - Immunology 2021
Quote:
... 2) a CE-Marked ELISA assay for detection of IgG against the full-length recombinant N protein from Epitope Diagnostics (EDITM Novel coronavirus COVID-19 IgG). The test has a specificity of 96% and a sensitivity of 81% after 28 days POS in our hands ...
-
No products found
because this supplier's products are not listed.
Jin Wang, et al.,
bioRxiv - Systems Biology 2019
Quote:
... RNA oligos (22 nt) with the following caps were synthesized by in vitro reaction of pppXGGCUCGAACUUAAUGAUGACG (Bio-Synthesis Inc. ...
-
No products found
because this supplier's products are not listed.
Mateo I Sanchez, Alice Y Ting,
bioRxiv - Synthetic Biology 2019
Quote:
... 0.54 g/L CSM –Ade – His –Leu –Lys –Trp –Ura (Sunrise Science Products)) ...
-
No products found
because this supplier's products are not listed.
Chengyao Wang, et al.,
bioRxiv - Bioengineering 2020
Quote:
Human intestinal epithelial cells Caco-2 (ATCC® HTB-37™) were cultured in a 75 cm2 cell culture flask (Nest Biotechnology) with complete 1X Eagle’s Modified Eagle Medium (EMEM ...
-
No products found
because this supplier's products are not listed.
Jamal Green, et al.,
bioRxiv - Immunology 2024
Quote:
... Gavages were performed using a sterile syringe and a straight 1-inch-long 22-gauge gavage needle (Cadence Science, #7901). For post-weaning colonization experiments ...
-
No products found
because this supplier's products are not listed.
MU Wagenhäuser, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... For the platelet depletion experiments mice were injected with platelet depletion antibody (Emfret Analytics, polyclonal anti-GPIb alpha #R300) and a corresponding IgG antibody (Emfret Analytics ...
-
No products found
because this supplier's products are not listed.
Andrew R. McEwan, et al.,
bioRxiv - Genetics 2021
Quote:
... from human DNA (Cambio, UK) using the following primers ...
-
No products found
because this supplier's products are not listed.
Tracy J. Berg, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Primary human astrocytes (3H Biomedical) were cultured in Astrocyte Medium (3H Biomedical ...
-
No products found
because this supplier's products are not listed.
Sandrine Huot, et al.,
bioRxiv - Immunology 2020
Quote:
... Human MPO and human Lactoferrin ELISA kits were purchased from Assaypro (St. Charles, MO, USA). MMP-9 Duoset ELISA was obtained from R&D Systems ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 2: 2-Amino-6-(prop-2-ynoxycarbonylamino)hexanoic acid (LysAlk, AstaTech); 3 ...
-
No products found
because this supplier's products are not listed.
Erin J. Vanzyl, et al.,
bioRxiv - Cell Biology 2020
Quote:
... ATF3 mRNA expression was determined using Bioline SensiFAST™ Probe HI-ROX Master Mix (FroggaBio Inc, Toronto, ON) with SYBR green ...
-
No products found
because this supplier's products are not listed.
Christopher W. Benson, et al.,
bioRxiv - Genomics 2023
Quote:
Fungal DNA was isolated from tissue grown in culture on potato dextrose agar (PDA; Alpha Biosciences Inc., Baltimore, MD) using the Fungi/Yeast Genomic DNA Isolation Kit (Norgen Biotek Corp., Ontario, Canada). High molecular weight DNA was prepared for sequencing using the SMRTbell Template Preparation kit (v.1.0) ...
-
No products found
because this supplier's products are not listed.
Chanchal Thomas Mannully, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 1 μg/mL of human TGFβ1 (Biogems, Peprotech).
-
No products found
because this supplier's products are not listed.
Aman Y. Husbands, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Membranes were washed three times with PBS-T and incubated with 1:2000 anti-His-tag antibody (Abiocode M0335-1) for 1h with gentle shaking at RT ...
-
No products found
because this supplier's products are not listed.
Patricia Aguilar-Calvo, et al.,
bioRxiv - Pathology 2023
Quote:
... full length recombinant mouse PrP (23-230) generated in E.coli was first conjugated to deferoxamine-maleimide (Macrocyclics) to produce deferoxamine-conjugated PrPC (DFO-PrPC) ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, James A. Van Deventer,
bioRxiv - Synthetic Biology 2021
Quote:
... (S)-2-amino-6-((2-azidoethoxy)carbonylamino)hexanoic acid (Iris Biotech), (S)-2-amino-6-(((prop-2-yn-1-yloxy)carbonyl)amino)hexanoic acid (AstaTech) ...
-
No products found
because this supplier's products are not listed.
Yan Wang, Meiling Lian, Liping Song, Shengzhou Wu,
bioRxiv - Neuroscience 2020
Quote:
... fractions using commercially available kits (Cat#CSB-E08299h for human Aβ40; Cat#CSB-E10684h for human Aβ42, CUSABIO TECHNOLOGY LLC, Wuhan, China) per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ava P. Soleimany, et al.,
bioRxiv - Bioengineering 2020
Quote:
Fresh frozen human PCa TMAs (BioChain Institute, Inc.; T6235201) were air dried and fixed in ice-cold acetone for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Astrid Hendriks, et al.,
bioRxiv - Microbiology 2023
Quote:
... Human neutrophils were freshly isolated using Polymorphprep (Alere technologies) per manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Jorge Gomez-Deza, et al.,
bioRxiv - Neuroscience 2023
Quote:
The Human Genome-Wide CRISPRi Dual-sgRNA Library (Cellecta KIDHGW-105K-P ...
-
Cat# G209,
USD $10.00/EA
Ask
Glory Nasseri, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...
-
No products found
because this supplier's products are not listed.
Padmapriya Sekar, et al.,
bioRxiv - Immunology 2023
Quote:
... 330 μg/mL iron-saturated human holo-transferrin (BBI solutions), 10 μg/mL recombinant human insulin (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Jasmine Alexander-Floyd, et al.,
bioRxiv - Immunology 2021
Quote:
... supernatants and recombinant cytokine standards were applied to anti-IL-1β antibody-coated (eBioscience) Immulon ELISA plates (ImmunoChemistry Technologies). IL-1β was detected using biotinylated anti IL-1β (eBioscience ...
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... The protein vaccines were alum-adjuvanted by adsorption of the recombinant fusion proteins to aluminum hydroxide (Alhydrogel®; Croda, Frederikssund, Denmark) as previously described22 ...
-
No products found
because this supplier's products are not listed.
Pascale Lemieux, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... and 2% DMSO (Bioshop Canada)) to an OD of 0.1 ...
-
No products found
because this supplier's products are not listed.
Yunxia Tang, et al.,
bioRxiv - Immunology 2019
Quote:
Human IFN-γ ELISPOT assays were performed by ELISPOT kit (Mab Tech). The plates were washed three times with PBS ...
-
No products found
because this supplier's products are not listed.
Salime Bazban-Shotorbani, et al.,
bioRxiv - Bioengineering 2021
Quote:
... MAL-PEG-NHS (2 kDa) and m-PEG-NHS (2 kDa) were obtained from Nanocs (USA).
-
No products found
because this supplier's products are not listed.
Subhrangshu Guhathakurta, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 μM purmorphamine (Reprocell, 04-0009), and 100 ng/ml recombinant human/mouse FGF-8b (Peprotech ...
-
No products found
because this supplier's products are not listed.
Duilio M. Potenza, et al.,
bioRxiv - Physiology 2024
Quote:
... and human cardiac fibroblasts was extracted with Trizol Reagent (TR-118, Molecular Research Center) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Michael D. Vahey, Daniel A. Fletcher,
bioRxiv - Microbiology 2019
Quote:
... NH2-PEG-OH (Rapp Polymere, 122000-2) supplemented with 2.5 mole-percent NH2-PEG-Biotin (Rapp Polymere ...
-
No products found
because this supplier's products are not listed.
Katherine Williams, et al.,
bioRxiv - Genomics 2021
Quote:
... and 2% Ultrasor G (Crescent Chemical Co.). Day 0 cells were kept at low confluency to prevent spontaneous differentiation ...
-
No products found
because this supplier's products are not listed.
Gayani Wijegunawardena, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 2-chlorotrityl resin was purchased from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Mean-Hwan Kim, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 350 µm thick human cortical slices were prepared using a Compressome VF-300 (Precisionary Instruments) or VT1200S (Leica Biosystems) ...
-
No products found
because this supplier's products are not listed.
Lihong Chen, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... 2 mg monoclonal antibody to collagen II (Chondrex) in 50 ul of PBS was administered by intraperitoneal injection ...
-
No products found
because this supplier's products are not listed.
Lina Freage, et al.,
bioRxiv - Biochemistry 2020
Quote:
... while OSJ-T3-OMe was synthesized by using the 2’-OMe-Ac-C-CE and 2’-OMe-U-CE phosphoramidites (Glen Research) to modify the 40th and 41st bases (Glen Research) ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Jinbao Liu, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Then the mixture was centrifuged at 200 g for 2 min and the supernatant was transferred to a new 2 mL Tube (CELLTREAT, catalog number: 229446) and centrifuged at 1,000 g for 5 min ...
-
No products found
because this supplier's products are not listed.
Tomohiko Sadaoka, et al.,
bioRxiv - Microbiology 2020
Quote:
DNA and RNA from VZV-infected human sensory neurons were isolated using the FavorPrep Blood/Cultured Cell Total RNA Mini Kit (Favorgen Biotech) in combination with the NucleoSpin RNA/DNA buffer set (Macherey-Nagel) ...
-
No products found
because this supplier's products are not listed.
Katrin Manske, et al.,
bioRxiv - Bioengineering 2023
Quote:
20,000 Human Embryonic Kidney cells (HEK293-CD19+) expressing the CD19 antigen were seeded on a 96-well E-plate (ACEA Biosciences) over night ...
-
No products found
because this supplier's products are not listed.
Robert S. Kellar, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The proteins were dissolved into 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP, Oakwood Chemical, Estill, SC). The biomimetic WHDs were prepared using a ratio of 9:1 collagen to rhTE ...
-
No products found
because this supplier's products are not listed.
Sing Teng Chua, et al.,
bioRxiv - Plant Biology 2023
Quote:
... sublimated at -90°C (2 minutes) and finally sputter coated with platinum (10 nm; Quorum Technologies Q150T ES).
-
No products found
because this supplier's products are not listed.
Anicca Harriot, et al.,
bioRxiv - Pathology 2023
Quote:
... Anesthetized mice (2-3% isoflurane) were placed in supine position on the temperature maintained (Deltaphase Isothermal Pad, Braintree Scientific) platform of an Aurora 3100 with the knee stabilized and foot affixed on the footplate of the torque transducer ...