-
No products found
because this supplier's products are not listed.
Siamak Salavatian, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 1 µL of an enzyme solution containing 1 U glutamate oxidase (Cosmo Bio USA, Carlsbad, CA, USA), 13.7 mg bovine serum albumin (Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
S. Jake Gonzales, et al.,
bioRxiv - Immunology 2021
Quote:
... 5 µg/ml TLR9-activator ODN2006 (IDT DNA, sequence TCGTCGTTTTGTCGTTTTGTCGTT), and 60 µg/ml transferrin (Sigma #616424 ...
-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Swayam Prakash Srivastava, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Urine albumin levels were assayed using a Mouse Albumin ELISA Kit (Exocell, Philadelphia, PA).
-
No products found
because this supplier's products are not listed.
Joakim Karlsson, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... cells were surface stained for 45 min in 37°C using Melanoma Dextramer Collection 1 kit from Immudex. Dead cells were excluded from the analysis using Live/Dead Aqua (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Laura E. Doepker, et al.,
bioRxiv - Immunology 2019
Quote:
Immunolon 2HB ELISA plates were coated with 1 μg ml−1 ZM109 gp120 monomer or C.ZA.1197MB gp41 ectodomain (Immune Technology Corp.) in 0.1M sodium bicarbonate ...
-
No products found
because this supplier's products are not listed.
Paresh P Kulkarni, et al.,
bioRxiv - Cell Biology 2023
Quote:
Protein C activity in WT and Apoh-/- plasma was performed using the Chromogenix Coamatic Protein C activity kit (Diapharma). Briefly ...
-
No products found
because this supplier's products are not listed.
Yongtao Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Using 7550-1-C ceramic blades (Campden Instruments Limited), the tissue was cut into 250 μm slices at an advance speed of 0.1 mm/s ...
-
No products found
because this supplier's products are not listed.
Helen R. McPherson, et al.,
bioRxiv - Physiology 2021
Quote:
... Tissue plasminogen activator (t-PA) was from Pathway Diagnostics (Dorking, UK) and human Glu-plasminogen from Enzyme Research Laboratories (Swansea, UK) and were prepared in ddH2O ...
-
No products found
because this supplier's products are not listed.
Lesia Rodriguez, et al.,
bioRxiv - Plant Biology 2022
Quote:
... affinity-purified TMK1 (1:1000, 59), AHA2 (1:1000, 73) and PIN2 (1:1000, 35) antibodies and anti-ROP6 (C) (1:1000, Abiocode), using anti-Rabbit HRP-conjugated (1:5000 ...
-
No products found
because this supplier's products are not listed.
Rafael D. González-Cruz, et al.,
bioRxiv - Bioengineering 2023
Quote:
... transferred to a 24-well polystyrene plate (see Fig. 1(c)) (CELLTREAT), and equilibrated with complete cortical media for 48 hours at 37°C prior to cell seeding ...
-
No products found
because this supplier's products are not listed.
Seth J. Zost, et al.,
bioRxiv - Immunology 2021
Quote:
... The plates were washed and 25 μL of ELISA buffer containing a 1:4,000 dilution of anti-human IgG alkaline phosphatase conjugate (Meridian Life Science, W99008A) was added ...
-
No products found
because this supplier's products are not listed.
Erika Riederer, et al.,
bioRxiv - Biophysics 2021
Quote:
... 1 µM valinomycin at 30 °C using 100 nM of 14C Asp (Moravek Biochemicals) as previously described.(33 ...
-
No products found
because this supplier's products are not listed.
Aminu S. Jahun, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... C-176 (Focus Biomolecules), or H-151 (Focus Biomolecules ...
-
No products found
because this supplier's products are not listed.
Sylwia Machcinska, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and C (CELLnTEC, Switzerland) was added per insert ...
-
No products found
because this supplier's products are not listed.
Barbara Ciralli, et al.,
bioRxiv - Neuroscience 2023
Quote:
... cannabinol (Cerilliant C-046) and CBD (Cerilliant C-045 ...
-
No products found
because this supplier's products are not listed.
Yuko Ishida, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... rat anti-mouse F4/80 mAb (clone, BM8; BMA Biomedicals, Switzerland), rabbit anti-human CD3 pAbs ...
-
No products found
because this supplier's products are not listed.
Shogo Soma, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats received 100 nL of Fluoro-Gold (2.5% in H2O, Fluorochrome) and 1,200 nL of mRFP expressing G-deleted rabies viral vector (rHEP5.0-ΔG-mRFP ...
-
No products found
because this supplier's products are not listed.
Yang-Xue Dai, et al.,
bioRxiv - Biophysics 2021
Quote:
... Crystallization screening was carried out at 20 °C using commercial screening kits (Hampton Research, Molecular Dimensions and Rigaku Reagents), where the ToPif1-DNA complex was mixed at a 1:1 ratio with the reservoir solution ...
-
No products found
because this supplier's products are not listed.
Yuanchen Yu, et al.,
bioRxiv - Microbiology 2020
Quote:
... The channel array was maintained at 37 °C with a TC-1-100s temperature controller (Bioscience Tools). For all direct comparisons ...
-
No products found
because this supplier's products are not listed.
Shuang Fu, et al.,
bioRxiv - Biophysics 2022
Quote:
... Ara-C (2 mM, TargetMol, T1272) was added to the medium to inhibit neural stem cell proliferation ...
-
No products found
because this supplier's products are not listed.
Timothy O'Leary, et al.,
bioRxiv - Biochemistry 2021
Quote:
Cells were washed with DPBS and incubated with cholPEGNTA (Nanocs # PG2-CSNT-2k; 10 μM, 1 hr, 37°C) After washing twice with DPBS ...
-
No products found
because this supplier's products are not listed.
Chiara M. Evans, et al.,
bioRxiv - Biochemistry 2021
Quote:
... These spectra were recorded on a JASCO J-815 CD Spectrometer (JASCO, Japan) at 25 °C using a 1.6 cm cell with a 1 mm path-length (Starna Cells, Inc.). ATAD2 bromodomain wild type (WT ...
-
No products found
because this supplier's products are not listed.
Grigorios Fanourgakis, et al.,
bioRxiv - Genetics 2024
Quote:
... After washing cells were incubated with 20 μg/ml with Hoechst 33342 (Thermo Fischer Scientific H3570) for 1 hour at 32°C with constant shaking and protected from light and then with 30nM DRAQ7 (Biostatus DR71000) for 5 minutes on bench ...
-
No products found
because this supplier's products are not listed.
Emily K. Sims, et al.,
bioRxiv - Pathology 2019
Quote:
... Three of the donors with type 1 diabetes had detectable random serum C-peptide and 13 were classified by nPOD as C-peptide negative (random serum C-peptide <0.017nmol/L via TOSOH immunossay) (12) ...
-
No products found
because this supplier's products are not listed.
Michael H Jones, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The primary antibody was visualized using Simple Mouse Stain MAX-PO (Rat) (Nichirei Biosciences, Tokyo, Japan) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Cinzia Klemm, Gudjon Olafsson, Peter H Thorpe,
bioRxiv - Cell Biology 2023
Quote:
3xFLAG-tagged Mif2CENP-C cells were harvested after 4 hours of growth at restrictive (37°C) or permissive (23°C) temperature and whole cell lysates were prepared using glass beads and a cell disrupter (Scientific Industries Inc.) in Laemmeli buffer containing an EDTA-free protease inhibitor cocktail (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Fabio Tommasini, et al.,
bioRxiv - Bioengineering 2023
Quote:
Tissue slides were stained using the Movat Pentachrome Stain kit (Cat. # MPS-1, Scytek, USA). Briefly ...
-
No products found
because this supplier's products are not listed.
Kévin Leguay, et al.,
bioRxiv - Cell Biology 2020
Quote:
Coelenterazine 400a (Deep Blue C) and methoxy e-CTZ (Prolume Purple) were purchased from NanoLight Technology (#340 and #369 ...
-
No products found
because this supplier's products are not listed.
Rebecca O’Cleirigh, Roslyn Gibbs,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and incubated at 37°C and 5% CO2 (Nuaire, DH Autoflow). Media was changed every 48 hours and cells passaged when they reached confluence as recommended by the supplier ...
-
No products found
because this supplier's products are not listed.
Federico Salas-Lucia, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Images were obtained using a transmission electron microscope (JEOL-100 C).
-
Cat# CT235-1,
USD $675.0/mg
Ask
Olga Bocharova, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Copy numbers of HSV-1 were measured using Virusys Corporation’s HSV-1 qPCR kit with a FAM/BHQ-labeled probe specific for glycoprotein D (gD) of HSV-1 (Virusys, Taneytown, MD, USA, cat. # H1K240). To build a calibration curve for determining an absolute copy number ...
-
No products found
because this supplier's products are not listed.
Yejin Jang, et al.,
bioRxiv - Microbiology 2020
Quote:
... Oseltamivir carboxylate (OSV-C) was purchased from United States Biological (Swampscott, MA, USA). Marine microalgae-derived sulfated polysaccharide p-KG03 was provided and characterized by Dr ...
-
No products found
because this supplier's products are not listed.
Niamh E. Harrington, et al.,
bioRxiv - Microbiology 2019
Quote:
... Tissue was incubated at 37 °C with a Breathe-Easier® membrane (Diversified Biotech) for the desired length of time.
-
No products found
because this supplier's products are not listed.
Wren E. Michaels, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Quantitative analysis of the CFTR B and C-bands was performed using Compass software (Protein Simple).
-
No products found
because this supplier's products are not listed.
Klaudia K. Maruszczak, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4°C) and the clarified supernatant was applied to a nickel affinity resin column (Cube Biotech). The column was first washed with the buffer mentioned above supplemented with 10 mM imidazole ...
-
No products found
because this supplier's products are not listed.
Heather A. Danhof, et al.,
bioRxiv - Microbiology 2023
Quote:
... and the slides were incubated at 4°C in a humid slide staining tray (Newcomer Supply, Middleton, WI, USA) overnight ...
-
No products found
because this supplier's products are not listed.
Measho H. Abreha, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 mM EDTA and 0.25 mM DTT) plus 100 μM ATP for 30 min at 37°C (SignalChem, K01-09). TBK1 kinase activity was inhibited by adding 100 μM or 200 μM of BX795 (ENZ-CHM189-0005 ...
-
No products found
because this supplier's products are not listed.
Juan A. Perez-Bermejo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
At least 5×107-3×108 Cryopreserved CD34+ HSPCs were then thawed at 37 °C and cultured in supplemented cytokine rich SCGM media (CellGenix) containing recombinant cytokines at 100 ng/mL each Flt-3L ...
-
No products found
because this supplier's products are not listed.
Hui Zhang, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Samples were boiled at 100 °C in a metal bath for 10 min in protein loading buffer (CoWin Biosciences, Beijing, China) and equal amount proteins were separated by 10% SDS-PAGE gel ...
-
No products found
because this supplier's products are not listed.
Lauren Rylaarsdam, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Organoid pieces were incubated for 75 minutes on a 95 RPM orbital shaker in a 37°C incubator and triturated using wide bore tips (Rainin, 30389218) every 30 minutes to help break up pieces ...
-
No products found
because this supplier's products are not listed.
Philippe Dehio, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The slides were first plasma cleaned and PEG-coated at 4 °C overnight with 200µg/ml poly(L-lysine)-PEG (SuSoS, PLL(20)-g[3.5]-PEG(2) ...
-
No products found
because this supplier's products are not listed.
Katy R. McCarron, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-LC3 (1:200 WB, 1:200 IF, Nanotools; 5F10), anti-p62 (1:1,000 WB ...
-
No products found
because this supplier's products are not listed.
Mathew Miller, et al.,
bioRxiv - Molecular Biology 2022
Quote:
MULTI-ARRAY Standard 96-well plates (Meso Scale Diagnostics, Rockville, Maryland) were coated overnight at 4°C with K1 anti-dsRNA mouse monoclonal antibody (SCICONS, Budapest, Hungary). Plates were blocked using 5% MSD Blocker A (Meso Scale ...
-
No products found
because this supplier's products are not listed.
Akash D. Chakraborty, et al.,
bioRxiv - Physiology 2023
Quote:
... SERCA2 (1:5000, Badrilla), CSQ2 (1:3000 ...
-
No products found
because this supplier's products are not listed.
Ewan Phillip Ramsay, et al.,
bioRxiv - Biochemistry 2020
Quote:
HeLa cells were transfected with a 1:1:1 mix of gRNA1 and gRNA2 vectors together with the donor plasmid using PolyJet transfection reagent (SL100688, SignaGen Laboratories) according to the manufacturer’s instructions ...
-
Cat# SC22000,
Coupling buffer+ Washing buffer + EDC, USD $76.00/KIT
Ask
Adam T. Vogel, Shelley J. Russek,
bioRxiv - Neuroscience 2021
Quote:
... using the NeuroMag Magnetofection™ kit (Oz Biosciences #KC30800). Plasmid DNA was diluted in NBM and added to the NeuroMag Transfection Reagent ...
-
No products found
because this supplier's products are not listed.
Xi Qiao, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and detected with PowerVision+ polymer kit (DPVB+110HRP; Immunovision Technologies ...
-
No products found
because this supplier's products are not listed.
Akul Singhania, et al.,
bioRxiv - Immunology 2021
Quote:
... 1% penicillin/streptomycin (Omega Scientific, Tarzana, CA), and 50 U/ml Benzonase (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Elizabeth B. Draganova, Ekaterina E. Heldwein,
bioRxiv - Microbiology 2021
Quote:
... a total of 10 μL of GUVs with a 3:1:1 molar ratio of POPC:POPS:POPA containing ATTO-594 DOPE (ATTO-TEC GmbH) at a concentration of 0.2 μg/μL was mixed with 1 μM NEC220 (final concentration) ...