-
No products found
because this supplier's products are not listed.
Atsushi Sugimoto, et al.,
bioRxiv - Microbiology 2022
Quote:
ELISA Kit (41135-1, PBL Assay Science, USA) and the Human IL-29/IL-28B (IFNλ1/3 ...
-
No products found
because this supplier's products are not listed.
Michael A. Flinn, et al.,
bioRxiv - Physiology 2022
Quote:
Primary cardiac fibroblasts were isolated from 2-day-old rats using a neonatal heart dissociation kit (Miltenyi Biotec) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Clara Hozer, Fabien Pifferi,
bioRxiv - Physiology 2021
Quote:
... We assayed plasma 8-hydroxy-2’-deoxyguanosine (8-OHdG) levels (OxiSelect™ Oxidative DNA Damage Elisa kit, Cell Biolabs Inc.) and insuline-like growth-factor 1 (IGF-1 ...
-
No products found
because this supplier's products are not listed.
Zhijun Chen,
bioRxiv - Cancer Biology 2023
Quote:
... CYCS/Cytochrome c ELISA Kit (LS-F11267) from LifeSpan BioSciences was used to determine the apoptosis of cells following the instructions of the kit ...
-
No products found
because this supplier's products are not listed.
Xiaoning Gao, et al.,
bioRxiv - Cell Biology 2024
Quote:
... ELISA kits from Solarbio, catalogue numbers SEKR-0002 ...
-
No products found
because this supplier's products are not listed.
Shaqed Carasso, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2 µl of 2% rat serum (Stemcell technologies) was added to each well for 15 minutes at room temperature and proceeded to further staining without a washing step.
-
No products found
because this supplier's products are not listed.
Nicole Y. Lai, et al.,
bioRxiv - Immunology 2019
Quote:
... then incubated in secondary antibodies in 0.1% Triton X-100/PBS for 2 hr at 4°C (goat anti-rat Alexa 488, Abcam, ab150157 at 1:500; donkey anti-rat Alexa 594, Jackson ImmunoResearch, 712-585-153 at 1:500 ...
-
No products found
because this supplier's products are not listed.
Patricia G. Izquierdo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... elegans cDNA library (OriGene) using 5’ AGAGAGAATGATGTTAGGAGG 3’ and 5’ AGTTGAAAATGAAAGAATAATGG 3’ (55°C annealing temperature ...
-
No products found
because this supplier's products are not listed.
Ross Peterson, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
A Sandwich ELISA (Bovine Lactoferrin ELISA kit, NBP3-12185, Novus Biologicals) was used and adopted to determine bovine lactoferrin concentrations in rat serum ...
-
No products found
because this supplier's products are not listed.
P Duarte-Guterman, et al.,
bioRxiv - Neuroscience 2023
Quote:
... (1:2, Rat adsorbed, Vector laboratories) diluted in TBS ...
-
No products found
because this supplier's products are not listed.
Rebecca S. Hofford, et al.,
bioRxiv - Neuroscience 2020
Quote:
A morphine ELISA kit (Abnova #KA0935) was used to quantify morphine in serum and DStr ...
-
No products found
because this supplier's products are not listed.
Adam J. Rocker, et al.,
bioRxiv - Bioengineering 2022
Quote:
... ELISA color development was monitored with an ELISA plate reader (BioTek Synergy 2 Multi-Mode Reader) at 405 nm with wavelength correction set at 650 nm ...
-
No products found
because this supplier's products are not listed.
Alia Hasan, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Serum PTH or PTH secreted to growth medium in organ cultures was measured using rat or mouse 1–84 Intact PTH ELISA kit (Quidel, Athens, Ohio).
-
No products found
because this supplier's products are not listed.
Elisa Vaiani, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... inhibin B and AMH/MIS by 2-site ELISA (Beckman Coulter and Beckman Coulter Gen II ...
-
No products found
because this supplier's products are not listed.
Poshen B. Chen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
We transduced cells with lentivirus carrying KRAB-dCas9 and sgRNA targeting candidate progrowth enhancers and performed puromycin (2 μg/ml) (InvivoGen) for three days postelectroporation to select against non-transduced cells ...
-
No products found
because this supplier's products are not listed.
Jeremy A. Herrera, et al.,
bioRxiv - Biochemistry 2019
Quote:
... then 60 °C for 2 hours while shaking at 1400 RPM (Eppendorf, ThermoMix C). To select for ECM proteins ...
-
No products found
because this supplier's products are not listed.
Qingwen Qian, et al.,
bioRxiv - Physiology 2022
Quote:
... were measured using commercially available ELISA kits (TSH ELISA kit, G-Biosciences, Cat No. IT6045; free T3 ELISA kit, G-Biosciences, Cat No. IT5691; T4 ELISA kit, G-Biosciences, Cat No ...
-
No products found
because this supplier's products are not listed.
Clément Blot, et al.,
bioRxiv - Microbiology 2023
Quote:
... Nrf2 TransAM ELISA-kit (Active Motif) was used to evaluate Nrf2 DNA-binding activity ...
-
No products found
because this supplier's products are not listed.
Melody Nicolau, et al.,
bioRxiv - Plant Biology 2020
Quote:
... or c-Myc rat monoclonal antibody (Chromotek, 9E1-100) at a dilution of 1:1000 followed by goat anti-rat IgG horseradish peroxidase (Abcam ...
-
No products found
because this supplier's products are not listed.
Joana Rajão-Saraiva, et al.,
bioRxiv - Neuroscience 2022
Quote:
... presenilin-1 [PSEN1] and microtubule-associated protein tau [MAPT]) (Mutant Mouse Research and Resource Center at The Jackson Laboratory) was used as control.
-
No products found
because this supplier's products are not listed.
Fok-Moon Lum, et al.,
bioRxiv - Immunology 2019
Quote:
... The DNase-treated RNA (2 μg) was treated with Ribo-Zero using an Epicentre Ribo-Zero Gold Kit (Human/Rat/Mouse) (Epicentre) and re-purified on Ampure XP beads.
-
No products found
because this supplier's products are not listed.
Milena Petkova, et al.,
bioRxiv - Cell Biology 2022
Quote:
Mouse Vascular Endothelial Cell Growth Factor C (VEGF-C) ELISA Kit from CUSABIO (CSB-E07361m) was used for detection of VEGF-C protein concentration ...
-
No products found
because this supplier's products are not listed.
Meagan N. Esbin, et al.,
bioRxiv - Cell Biology 2024
Quote:
... + 1:1000 Enhancer (Biotium) and incubated for ∼10-15min before starting imaging ...
-
No products found
because this supplier's products are not listed.
Tyler B. Waltz, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Depletion of p11 from the media was confirmed using Rat S100 Calcium Binding Protein A10 (S100A10) ELISA Kit (Biomatik, Cat# EKN48271-96T) as per the attached instructions.
-
No products found
because this supplier's products are not listed.
Zhiqing Huang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Enzyme-linked immunosorbent assays (ELISA) using the human POSTN ELISA kit from Aviva Systems (Cat # OKCD09048 ...
-
No products found
because this supplier's products are not listed.
Pragya D Yadav, et al.,
bioRxiv - Microbiology 2021
Quote:
... Briefly, ACE-2 protein (Acro Biosystems, USA) was coated onto ELISA plates (Greiner, Germany) at 1 μg/mL concentration in PBS and was incubated (for 12-72 hours ...
-
No products found
because this supplier's products are not listed.
Bahia Bekhouche, et al.,
bioRxiv - Genetics 2019
Quote:
... followed by a 30 min incubation with signal enhancer Amplify NAMP100 (GE Healthcare). The radiolabeled products were revealed using Typhoon phosphoimager.
-
Rat Presenilin Enhancer 2 Homolog (C. Elegans) (PSENEN) ELISA Kit is an ELISA Kit for the in...
Cat# abx556263-96T,
96 tests USD $797.5
Ask
Robert Schierwagen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
We determined plasma levels of beta-arrestin-2 using an ELISA kit (Human Beta-arrestin-2 ELISA Kit; # abx251362; Abbexa) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Shuai-Qi Liu, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... After fluorounce enhancer (Epigentek) and fluorounce developer (Epigentek ...
-
No products found
because this supplier's products are not listed.
Seyed. M. Ghiasi, et al.,
bioRxiv - Cell Biology 2023
Quote:
Insulin concentration (ng/ml or pM) was measured using rat insulin ultra-sensitive ELISA kit (Cat#62IN2PEG, Cisbio, Cambridge, England) or human insulin ELISA kit (Cat#90095 ...
-
No products found
because this supplier's products are not listed.
Aina Badia-Soteras, et al.,
bioRxiv - Neuroscience 2022
Quote:
... rat anti-c-Fos (1:500, Synaptic Systems, Germany). All secondary antibodies were used at 1:400 (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Timur O Yarovinsky, et al.,
bioRxiv - Immunology 2019
Quote:
... We used HBsAg ELISA kit from XpressBio and the HBsAg standard from CellBioLabs to measure serum HBsAg in the chronic HBV infection model.
-
No products found
because this supplier's products are not listed.
M Gueuning, et al.,
bioRxiv - Genetics 2024
Quote:
... we added 1 M of Betaine enhancer (VWR) per reaction ...
-
No products found
because this supplier's products are not listed.
Sarah M. Mohr, et al.,
bioRxiv - Physiology 2024
Quote:
... injected with 2 mg/kg acylated rat ghrelin (1465, Tocris) solubilized in PBS using an injection volume of 2 mL/kg body weight ...
-
No products found
because this supplier's products are not listed.
Alice V. R. Lake, et al.,
bioRxiv - Cell Biology 2020
Quote:
... anti-Smoothened homolog (Bioss antibodies, bs-2801R).
-
No products found
because this supplier's products are not listed.
M. Giovannetti, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... elegans animals were transferred to 2 ml MN Bead Tubes Type A (Macherey-Nagel, Düren, Germany) and lysed using a Precellys Bead Beating system with an additional Cryolys cooling module (Bertin Instruments ...
-
No products found
because this supplier's products are not listed.
Tomoki Togashi, et al.,
bioRxiv - Bioengineering 2023
Quote:
... hPC antigen (hPC:Ag) was measured using the Human Protein C AssayMaxTM ELISA Kit (Assaypro, St. Charles, MO) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Seokho Kim, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Active GLP-1 (7-36) was measured using the Mouse / Rat GLP-1 Active (7-36) ELISA Kit (Eagle Biosciences, GP121-K01).
-
No products found
because this supplier's products are not listed.
Feng Li, et al.,
bioRxiv - Genetics 2019
Quote:
A Hi-C library was constructed with the ProxiMeta Hi-C kit from Phase Genomics v 1.0 containing the enzyme Sau3A ...
-
No products found
because this supplier's products are not listed.
Jennifer L. Reedy, et al.,
bioRxiv - Immunology 2023
Quote:
... For the R&D Duoset kits the ELISA were read using an i3X Spectrophotometer (Molecular Devices, LLC). For the LegendPlex assays ...
-
No products found
because this supplier's products are not listed.
Stefania Capone, et al.,
bioRxiv - Immunology 2020
Quote:
RBD/ACE-2 neutralization ELISA (ACROBiosystems) was performed according to manufacturer instruction ...
-
No products found
because this supplier's products are not listed.
Lasse F. Voss, et al.,
bioRxiv - Immunology 2022
Quote:
... antibody (either “14D12” rat IgG2a to mouse MBL-C (Hycult Biotech), or “RTK2758” rat IgG2a isotype control (Abcam) ...
-
No products found
because this supplier's products are not listed.
Kameron Y. Sugino, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Maternal serum samples collected at 0.6 G were analyzed for C-reactive protein (CRP) using an hsCRP ELISA kit (MP Biomedicals, Solon, OH) according to the manufacturer’s protocol with 1:100 serum dilution and were analyzed for IL-6 using an old world monkey IL-6 ELISA kit (U-CyTech Biosciences ...
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
No products found
because this supplier's products are not listed.
Jesse M. Hall, et al.,
bioRxiv - Microbiology 2021
Quote:
... ELISA plates were washed as described above and 100μl of secondary goat anti-rat IgG (SouthernBiotech Cat. 3030-04), goat anti-rat IgM (SouhternBiotech Cat ...
-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
Chromatographically purified. A dialyzed, lyophilized pre-activated powder.
Cat# LS001643,
5x1 mg, $166.00
Ask
Tilman Werner, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... samples were digested with 1:50 (m/m) lysyl endopeptidase C (Fujifilm) at 42 °C for 2 hours and 1:50 (m/m) trypsin (Worthington) at 37 °C overnight ...
-
No products found
because this supplier's products are not listed.
Mizuki Kurashina, et al.,
bioRxiv - Neuroscience 2020
Quote:
... elegans using a Zeiss LSM800 Airyscan confocal microscope (Carl Zeiss, Germany) with oil immersion lens 63x magnification (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... RANKL and insulin were measured by mouse Osteocalcin ELISA Kit (BioVision), OPG ELISA Kit (Boster Biological Technology) ...
-
No products found
because this supplier's products are not listed.
Senthilvelrajan Kaniyappan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... covered with either 2 nm amorphous carbon (Quantifoil, R2/1+2 nm C) or graphene were used for sample preparation ...