-
No products found
because this supplier's products are not listed.
Ankita Datey, et al.,
bioRxiv - Microbiology 2019
Quote:
The serum samples were also subjected to indirect ELISA to detect the presence of IgG antibodies against JEV using Porcine JE IgG ELISA Kit (Glory Science Co., Ltd, USA) in accordance with the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Ho-Shiang Huang, Chan-Jung Liu,
bioRxiv - Biochemistry 2021
Quote:
Commercial kits were used to determine the urine level of NGAL (NGAL ELISA Kit, BioPorto Diagnostics A/S, Copenhagen, Denmark) and the urine levels of stone-induced renal tubular damage markers ...
-
No products found
because this supplier's products are not listed.
Jesica Romina Canizo, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... The Large Tumor Suppressor Kinase (LATS) inhibitor (TRULI, Enamine; Z730688380)3,60 and the PKC inhibitor (Gö6983 ...
-
No products found
because this supplier's products are not listed.
Samuel Schmidt, et al.,
bioRxiv - Cell Biology 2020
Quote:
... incubated 24h at 4 °C) were used as substrates and prepared in Willco dishes (35 mm, Willco Wells B.V., HBSt-3522) as described46 ...
-
No products found
because this supplier's products are not listed.
Aggeliki Tserga, et al.,
bioRxiv - Systems Biology 2021
Quote:
... Urinary albumin concentration was measured by ELISA using the AlbuWell kit (WAK-Chemie Medical GmbH, Steinbach, Germany). Urinary creatinine concentration was measured by the colorimetric method of Jaffe ...
-
No products found
because this supplier's products are not listed.
Alejandro Osorio-Forero, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Zürich) at an injection rate of 50-100 nL/min using a thin glass pipette (5-000-1001-X, Drummond Scientific) pulled on a vertical puller (Narishige PP-830) ...
-
No products found
because this supplier's products are not listed.
Zarna Rajeshkumar Pala, et al.,
bioRxiv - Microbiology 2023
Quote:
... or Tyrode’s buffer (negative control) were added to the platelet rich plasma and were placed in a Chrono-Log aggregometer model 700 (Chrono-Log Corporation) and stirred at 1200 rpm at 37 °C for 1 min prior to the addition of ADP (0.3μM ...
-
No products found
because this supplier's products are not listed.
Zsuzsa Csobán-Szabó, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 0.5 mM biotin-pentylamine substrate (Zedira) and 10 mm DTT and 5 mM Ca2+ at 37 °C for 45 min ...
-
No products found
because this supplier's products are not listed.
Preetha Shridas, et al.,
bioRxiv - Pathology 2023
Quote:
Plasma SAA (SAA1.1 and SAA2.1 isoforms) concentrations were determined using a mouse SAA ELISA kit (cat no TP 802M, Tridelta Development Ltd). Plasma cholesterol concentrations were measured using enzymatic kits (Wako Chemicals).
-
No products found
because this supplier's products are not listed.
Jesse Garcia Castillo, et al.,
bioRxiv - Immunology 2024
Quote:
... Quantification of IgG for samples was done by diluting serum samples and using the Mouse IgG ELISA commercial kit (Molecular Innovations). For treatment ...
-
No products found
because this supplier's products are not listed.
Xiaoyi Zheng, et al.,
bioRxiv - Immunology 2021
Quote:
We quantified human serum Esm-1 by ELISA (Lunginnov, Lille, France) and mouse plasma Esm-1 by ELISA (Aviscera Biosciences, Santa Clara, CA), following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
E. Albizzati, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Immunocomplexes were visualized using the ECL substrates kits from Cyanagen and imaged on ALLIANCE MINI HD9 system (UVITEC Ltd, UK). Quantification of bands was performed using the Uvitec Nine Alliance Software ...
-
No products found
because this supplier's products are not listed.
Yunbing Shen, et al.,
bioRxiv - Immunology 2024
Quote:
... TMB substrate (Medicago, Cat. No. 10-9405-250) was added ...
-
No products found
because this supplier's products are not listed.
Christopher D. Kegelman, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and diaminobenzidine substrate chromogen system (329ANK-60; Innovex Biosciences), which allowed for immunohistochemical detection of positively stained cells ...
-
No products found
because this supplier's products are not listed.
Katherine L. Leiby, et al.,
bioRxiv - Bioengineering 2022
Quote:
Primary rat lung microvascular endothelial cells (RLMVEC, VEC Technologies) were cultured on fibronectin (1 μg/cm2 ...
-
No products found
because this supplier's products are not listed.
Haixia Zhang, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Fresh rat serum (RS) was purchased from Lampire Biological Laboratories (Pipersville ...
-
No products found
because this supplier's products are not listed.
Alexandra Turfe, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Rats were assigned to either a corticosterone (CORT; Lkt Laboratories) or a VEH group ...
-
No products found
because this supplier's products are not listed.
Greg T. Chism, Wiley Faron, Anna Dornhaus,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... and then weighed each substrate using a digital scale (Ohaus, USA) to the nearest 0.00001g.
-
No products found
because this supplier's products are not listed.
Joakim Karlsson, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... cells were surface stained for 45 min in 37°C using Melanoma Dextramer Collection 1 kit from Immudex. Dead cells were excluded from the analysis using Live/Dead Aqua (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Aminu S. Jahun, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... C-176 (Focus Biomolecules), or H-151 (Focus Biomolecules ...
-
No products found
because this supplier's products are not listed.
Shogo Soma, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats received 100 nL of Fluoro-Gold (2.5% in H2O, Fluorochrome) and 1,200 nL of mRFP expressing G-deleted rabies viral vector (rHEP5.0-ΔG-mRFP ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... 500 nM substrate RNA (5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3, Bio-Synthesis, Inc.), and 60 nM yDcpS at 37 °C for 60 minutes ...
-
No products found
because this supplier's products are not listed.
Xiaoyu Sun, et al.,
bioRxiv - Biophysics 2020
Quote:
For experiments that involve plating cells on glass or hydrogel substrates (Matrigen), the substrates were coated with 10 μg/mL fibronectin ...
-
No products found
because this supplier's products are not listed.
NV DiBenedetto, et al.,
bioRxiv - Microbiology 2023
Quote:
... The same procedure is used for the Toxin B ELISA but N4A8 monoclonal antibodies (BBI solution) diluted at 4ng/ml in PBS was used for the capture antibodies and the T4G1 monoclonal antibodies previously coupled to biotin were used as detection antibodies (BBI solution ...
-
No products found
because this supplier's products are not listed.
Annette B. Vogel, et al.,
bioRxiv - Immunology 2020
Quote:
... and bound IgG was detected using an HRP-conjugated secondary antibody and TMB substrate (Biotrend). Data collection was performed using a BioTek Epoch reader and Gen5 software version 3.0.9 ...
-
No products found
because this supplier's products are not listed.
J. De Smet, et al.,
bioRxiv - Microbiology 2021
Quote:
... both larval and substrate samples were also homogenized using a stomacher (BagMixer 400CC, Interscience, France) for 1 minute.
-
No products found
because this supplier's products are not listed.
Jian Cui, et al.,
bioRxiv - Immunology 2023
Quote:
... 12.5 μL of the FXa substrate RGR-XaChrom (4 mM, Enzyme Research Laboratories#100-03) was added and the mixture was incubated at 37 °C for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Rhett A. Snyder, et al.,
bioRxiv - Microbiology 2019
Quote:
... Quantification of c-di-GMP in sample extracts was determined using a standard curve generated from chemically synthesized c-di-GMP (AXXORA). The standard curve solutions were prepared using twofold serial dilutions of c-di-GMP (1.25 μM – 19 nM ...
-
No products found
because this supplier's products are not listed.
Haichen Wang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1.0 U in 0.40 mL normal saline for rats) via Hamilton syringe (Hamilton Company; Reno, NV) advanced into the cortex (depth = 3 mm in mouse ...
-
No products found
because this supplier's products are not listed.
Julia L. Daiß, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Top2a was obtained from Inspiralis (c/n HT210). Proteins were incubated together in pulldown buffer (25 mM TrisHCl pH7.9 ...
-
No products found
because this supplier's products are not listed.
Amanda P. Waller, et al.,
bioRxiv - Pathology 2020
Quote:
... ELISA and immunoblot antibodies were validated using species-specific positive (purified species-specific protein; Haematologic Technologies, Inc, Essex Juntion, VT) and non-specific protein negative controls ...
-
No products found
because this supplier's products are not listed.
Ido Lavi, et al.,
bioRxiv - Microbiology 2023
Quote:
The following antibodies were used for immunofluorescence studies: Rat anti LANA (Advanced Biotechnologies, cat#13-210-100), Mouse anti LANA (Leica ...
-
No products found
because this supplier's products are not listed.
Marc Ramos-Llorens, et al.,
bioRxiv - Biochemistry 2024
Quote:
... All FA substrates (>98–99% pure) used for the functional characterisation assays were obtained from Nu-Chek Prep, Inc ...
-
No products found
because this supplier's products are not listed.
Cinzia Klemm, Gudjon Olafsson, Peter H Thorpe,
bioRxiv - Cell Biology 2023
Quote:
3xFLAG-tagged Mif2CENP-C cells were harvested after 4 hours of growth at restrictive (37°C) or permissive (23°C) temperature and whole cell lysates were prepared using glass beads and a cell disrupter (Scientific Industries Inc.) in Laemmeli buffer containing an EDTA-free protease inhibitor cocktail (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Jonathan H. Shrimp, et al.,
bioRxiv - Biochemistry 2022
Quote:
... was added Cbz-SKPSKRSFIED substrate (2.5 mM, 200 nL, 250x) and inhibitor (200 nL, 250x) using an ECHO 655 acoustic dispenser (LabCyte). To that was dispensed TMPRSS2 (reconstituted in 50% glycerol at 8.75 μM ...
-
No products found
because this supplier's products are not listed.
Owen J. Chen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... MEFs were maintained at 37°C in DMEM (Wisent Bioproducts: 4.5 g/L glucose ...
-
No products found
because this supplier's products are not listed.
Weimin Lin, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The antibodies respectively are anti-C/EBPα (ZEN BIO, 383901) and anti-FoxO1 (ZEN BIO ...
-
No products found
because this supplier's products are not listed.
Margaret M. McDaniel, Vitaly V. Ganusov,
bioRxiv - Immunology 2019
Quote:
... We fitted either recirculation model (panels A&C, see eqns. (3)–(9) ...
-
No products found
because this supplier's products are not listed.
Tomoki Takeda, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Rats (8 weeks old) were administered a single intratracheal dose of clodronate liposome or control liposome (LIPOSOMA, Inc., Amsterdam, The Netherlands) at a dose of 1 ml/kg ...
-
No products found
because this supplier's products are not listed.
Jenna Treissman, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 4 °C: Anti-HLA-G (1:100, 4H84, Exbio, Vestec, Czech Republic); anti-cytokeratin 7 ...
-
No products found
because this supplier's products are not listed.
Rafael D. González-Cruz, et al.,
bioRxiv - Bioengineering 2023
Quote:
... transferred to a 24-well polystyrene plate (see Fig. 1(c)) (CELLTREAT), and equilibrated with complete cortical media for 48 hours at 37°C prior to cell seeding ...
-
No products found
because this supplier's products are not listed.
Yan Ni, et al.,
bioRxiv - Bioengineering 2020
Quote:
Cardiac Troponin I (8T53) and C-reactive protein (8C72) were purchased from Hytest. Anti-cetuximab (HCA221) ...
-
No products found
because this supplier's products are not listed.
Simon Marlaire, Christoph Dehio,
bioRxiv - Microbiology 2020
Quote:
... the peptides were loaded on a C-18 column (The Nest Group, SS18V) pre-equilibrated with buffer A (0.1% TFA) ...
-
No products found
because this supplier's products are not listed.
Jonathan H Massey, et al.,
bioRxiv - Genetics 2019
Quote:
... 5 flies were placed in a single glass vial (Wheaton 224740 E−C Clear Glass Sample Vials) on ice ...
-
Kit consists of 1- 500mL SF-4Z0-500 Serum-Free Medium, 1- 8mL vial of RocketFuel™ (containing...
Cat# SF-4Z0-500,
518.0 mL, $250.0
Ask
Yuriko Tachida, et al.,
bioRxiv - Neuroscience 2022
Quote:
Human brain microvascular endothelial cells (BMECs, Applied Cell Biology Research Institute) were cultured in CS-C complete medium (Cell Systems) with FBS and used within four passages ...
-
No products found
because this supplier's products are not listed.
John J. McInnis, et al.,
bioRxiv - Neuroscience 2023
Quote:
... in 47.5 mL borate buffer (100 mM Boric Acid, 75 mM Sodium Chloride, pH 8.4, Boston Bioproducts Inc. C-8852S) overnight at room temperature ...
-
No products found
because this supplier's products are not listed.
Xiaoquan Zhu, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and concentrated using ViraTrap lentivirus purification kit (Biomiga). NIH3T3 or RWPE-1 cells or PC3 or LNCaP at 90% confluence were infected with Lenti-FOXP2 ...
-
No products found
because this supplier's products are not listed.
Abigail A. Mornement, et al.,
bioRxiv - Physiology 2023
Quote:
... Lysate was incubated for 1.5 hours at 55 °C then transferred to screw cap vials containing 0.4 g sterilised low binding 100-micron silica beads (OPS Diagnostics, BLBG 100-200-11) and vortexed for 10 minutes at max speed ...
-
No products found
because this supplier's products are not listed.
Derin Sevenler, Mehmet Toner,
bioRxiv - Bioengineering 2023
Quote:
... The Ultra Rainbow Calibration bead kit (Spherotech URCP-38-2k) consists of 3.8 µm polystyrene particles which contain embedded six different fluorochromes that align to the most common flow cytometry excitation and emission filter sets ...
-
No products found
because this supplier's products are not listed.
Omer Ziv, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... we used LipoJet In Vitro DNA and siRNA Transfection Kit (SignaGen Laboratories), according to the manufacturer’s protocol ...