-
A purified powder obtained from adapted cells of a mutant strain. Activity on androsterone...
Cat# LS004911,
Bulk, Inquire
Ask
M Iqbal Hossain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 1 unit/mL glucose-6-phosphate dehydrogenase (Worthington)] in a cuvette ...
-
No products found
because this supplier's products are not listed.
Anne Margriet Heijink, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and beta-Actin (MP Biomedicals, 69100 1:10000). Horseradish peroxidase (HRP)-conjugated secondary antibodies (DAKO ...
-
No products found
because this supplier's products are not listed.
Wataru Shihoya, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 1% n-dodecyl-beta-D-maltopyranoside (DDM) (Calbiochem), 0.2% CHS ...
-
No products found
because this supplier's products are not listed.
Lun Zhang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... in samples from brain lysates of mice and cell culture supernatants were determined using corresponding ELISA kits (pro-inflammatory cytokine ELISA kits were obtained from Neobioscience technology, anti-inflammatory cytokine ELISA kits were obtained from Bioss) according to the manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Wei-Chun Chang, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... a cortisol ELISA kit (Salivary Cortisol Enzyme Immunoassay Kit, Salimetrics) was used according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Annett Boeddrich, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... diluted 1:18 in standard diluent delivered with the Arl8b ELISA kit (CUSABIO, CSB-EL002100HU). All steps were performed according to supplier protocols ...
-
No products found
because this supplier's products are not listed.
Wen Xiao, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 1 μL Amino-11-ddUTP (10 mM in H2O, Lumiprobe), 8 μL of 5x TdT buffer (Thermo scientific) ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... I-FABP (Human I-FABP ELISA Kit, Hycult biotech, Cat# HK406), and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit ...
-
No products found
because this supplier's products are not listed.
Michael T.S. Girling, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
The MethylFlash Global DNA Methylation (5-mC) ELISA Easy Kit (Epigentek, USA), utilising a colourimetric assay ...
-
No products found
because this supplier's products are not listed.
Anna V. Elleman, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 11 mM glucose using a vibratome (Leica VT1200). Slices were then transferred to artificial cerebral spinal fluid (aCSF ...
-
No products found
because this supplier's products are not listed.
Ilona A. Kesisova, et al.,
bioRxiv - Cell Biology 2020
Quote:
... anti-alpha/beta tubulin (1:100; Cytoskeleton). F(ab’)2 fragment affinity-purified secondary antibodies (1:200 ...
-
No products found
because this supplier's products are not listed.
Juncai Ma, et al.,
bioRxiv - Plant Biology 2020
Quote:
... and isocitrate dehydrogenase (IDH; Agrisera), Cycloartenol-C24-methyl transferase (SMT1 ...
-
No products found
because this supplier's products are not listed.
Julia Prigann, et al.,
bioRxiv - Microbiology 2023
Quote:
... anti-HIV-1 p24 (#11-327; ExBio), anti-HIV-1 gp120 (provided by Valerie Bosch) ...
-
No products found
because this supplier's products are not listed.
Anna V. Elleman, et al.,
bioRxiv - Neuroscience 2023
Quote:
... beta subunit (Cedarlane, Ontario, Canada)).41 Cells were fed every 2–4 days by changing 50% of the working medium.
-
No products found
because this supplier's products are not listed.
Joshua D. Powell, et al.,
bioRxiv - Microbiology 2024
Quote:
... ELISA (IDEXX) and HI assays were performed on serum from contact pigs at 17 dpc to determine if IAV-specific antibodies were present to indicate virus transmission.
-
No products found
because this supplier's products are not listed.
Qi Ding, et al.,
bioRxiv - Neuroscience 2019
Quote:
... PI3 kinase activity was measured using PI3 kinase activity ELISA kit from Echelon Biosciences according to the manufacture’s protocol ...
-
No products found
because this supplier's products are not listed.
Martina Preiner, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
The pH of individual reaction mixtures was determined via TRITEST L pH 1–11 pH papers (Macherey-Nagel) directly after the reaction ...
-
No products found
because this supplier's products are not listed.
Sethu C. Nair, et al.,
bioRxiv - Microbiology 2022
Quote:
... 40 µL of fixed parasite sample was added to 11 mm wells in PTFE printed microscope slides (Electron Microscopy Sciences, Cat No: 63422-11) and incubated for half an hour ...
-
No products found
because this supplier's products are not listed.
Jody Vykoukal, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Sphingomyelin(18:1/18:1-d9) and C11 TopFluor Sphingomyelin (N-[11-(dipyrrometheneboron difluoride)undecanoyl]-D-erythro-sphingosylphosphorylcholine) (Avanti Polar Lipids 791649 and 810265P). Azithromycin (MedChemExpress ...
-
No products found
because this supplier's products are not listed.
Julie Tourn, et al.,
bioRxiv - Pathology 2024
Quote:
... The rat anti-mouse GPIb-beta Dylight 488 (clone X488, Emfret analytics) and the rat anti-mouse CD62P Alexa Fluor 647 (clone RB40.34 ...
-
No products found
because this supplier's products are not listed.
Matthew L. Turner, et al.,
bioRxiv - Microbiology 2019
Quote:
Lactate dehydrogenase leakage from cells was measured in cell supernatants using a Lactate Dehydrogenase Activity Assay Kit (Cambridge Bioscience) [6 ...
-
No products found
because this supplier's products are not listed.
Ka Lin Heck-Swain, et al.,
bioRxiv - Immunology 2022
Quote:
... as described (38) using cTnI ELISA Kit (Life Diagnostic, #CTNI-1-HS).
-
No products found
because this supplier's products are not listed.
Rufaida Wasim, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... AGE levels were measured in homogenates and serum using an ELISA kit designed specifically for use with rats (ABIN368041, antibodies-online GmbH, Aachen, Germany) in accordance with the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Justin E. Silpe, et al.,
bioRxiv - Microbiology 2022
Quote:
... coli: 200 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG, GoldBio), 0.1% L-arabinose (Sigma) ...
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
No products found
because this supplier's products are not listed.
Dhanushika Ratnayake, et al.,
bioRxiv - Cell Biology 2020
Quote:
... rat anti-mCherry antibody (1:500, Kerafast) (immunohistochemistry) ...
-
No products found
because this supplier's products are not listed.
Seung-Eon Roh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... CSF Orexin A was detected using a competitive ELISA Kit (Phoenix Pharmaceuticals) (Liguori et al ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5333-1KIT,
1 gram, USD $325.0
Ask
Alexander Bigger-Allen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 6.56mL of rat tail type 1 collagen (Advanced Biomatrix), all reagents were kept on ice until ready to mix ...
-
No products found
because this supplier's products are not listed.
Tania J. Lebratti, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-18 was measured using the mouse IL-18 ELISA kit (MBL International) according to manufacturer’s instructions at half-volumes.
-
No products found
because this supplier's products are not listed.
Weijie Huang, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The OptimAb HA.11 monoclonal antibody (Eurogentec) was used to detect hemagglutinin (HA)-fusion proteins at the concentration of 0.5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Sandhya Singh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and beta-gal plasmid using PEI Max 40000 (PolySciences, USA). The next day transfection medium was exchanged with fresh medium ...
-
No products found
because this supplier's products are not listed.
Robert Bucki, et al.,
bioRxiv - Biophysics 2022
Quote:
... rat tail 5mg/ml (Ibidi) were diluted on ice to 1.5mg/ml with 6.67% of 5x DMEM (Fisher scientific) ...
-
No products found
because this supplier's products are not listed.
Pedro J. del Rivero Morfin, et al.,
bioRxiv - Physiology 2023
Quote:
Culturing kits for rat hippocampi at embryonic age 18 were procured from Transetyx Tissue by BrainBits (Tranetyx Inc). Neurons were isolated from hippocampi using papain in Ca2+-free medium (2 mg/mL ...
-
No products found
because this supplier's products are not listed.
Zijun Wang, et al.,
bioRxiv - Immunology 2021
Quote:
... The developing reaction was stopped by adding 50 μl 1 M H2SO4 and absorbance was measured at 450 nm with an ELISA microplate reader (FluoStar Omega 5.11, BMG Labtech) with Omega MARS software for analysis ...
-
No products found
because this supplier's products are not listed.
Andrew McEwan, et al.,
bioRxiv - Genetics 2020
Quote:
... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
No products found
because this supplier's products are not listed.
Xing-Hua Liao, et al.,
bioRxiv - Cell Biology 2020
Quote:
Cardiac myocytes were isolated from day 1-3 Sprague-Dawley rat pups as described previously.(11–13) COS7 cells were bought from American Type Culture Collection (ATCC) and cultured in Dulbecco’s modified Eagle’s medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Wei-Ping Hu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Human BMPR2 ELISA Kit (orb406355, Biorbyt, United Kingdom) was used to detect the level of soluble BMPR2 in serum ...
-
No products found
because this supplier's products are not listed.
Yuewen Zhang, et al.,
bioRxiv - Biophysics 2020
Quote:
... and alcohol dehydrogenase (alc, dehydr) from Alfa Aesar. All the proteins were dissolved in 25 mM phosphate buffer at pH 8.0 to a micromolar concentration range ...
-
No products found
because this supplier's products are not listed.
Jennifer O’Brien, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and chicken anti-beta-tubulin 3 (Aves Labs, TUJ-0020, 1:500).
-
No products found
because this supplier's products are not listed.
Yasuaki Yanagawa, et al.,
bioRxiv - Microbiology 2019
Quote:
... histolytica antibody was detected using a commercially available ELISA kit (Entamoeba histolytica IgG-ELISA; GenWay Biotech, Inc., San Diego, CA. USA). All procedures were performed according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Beibei Wu, et al.,
bioRxiv - Microbiology 2021
Quote:
... that for detection of interferon alpha and beta receptor 1 (IFNAR-1) was purchased from Leinco Technologies, Inc ...
-
No products found
because this supplier's products are not listed.
Sybille Koehler, et al.,
bioRxiv - Cell Biology 2020
Quote:
Urinary albumin levels were measured with a mouse albumin ELISA kit (ICL/Dunn Labortechnik GmbH ...
-
No products found
because this supplier's products are not listed.
Solène Moulin, et al.,
bioRxiv - Plant Biology 2020
Quote:
... A Zebron 7HG-G007-11 (Phenomenex) polar capillary column (length 30 m ...
-
No products found
because this supplier's products are not listed.
Kang Wang, et al.,
bioRxiv - Microbiology 2022
Quote:
... Beta RBD (ACROBiosystems, Cat No. SPD-C52Hp), Gamma RBD (ACROBiosystems ...
-
No products found
because this supplier's products are not listed.
Natalia Pinello, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... incubated in blocking buffer with 1:500 rat anti-5hmC (Diagenode) overnight at 4°C and followed by incubation with 1:1000 anti-rat IgG HRP (ab6734 ...
-
No products found
because this supplier's products are not listed.
John L. Chodkowski, Ashley Shade,
bioRxiv - Microbiology 2022
Quote:
... DNA was extracted from all 11 cultures using the E.Z.N.A.® Bacterial DNA Kit (Omega Bio-tek, Norcross, GA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jonathan R Baker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... IL-36γ and IL-36RA were quantified using commercially available ELISA kits (AdipoGen life sciences, Epalinges, Switzerland); The lower limit of detection for these assays were 3.9 pg/ml (IL-36γ ...
-
No products found
because this supplier's products are not listed.
Takashi Takekawa, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and Figure 11 were acquired using a Nikon A1MP (Nikon, Tokyo, Japan) equipped with a 16x ...
-
No products found
because this supplier's products are not listed.
Xi Chen, et al.,
bioRxiv - Bioengineering 2021
Quote:
PC12 cell or rat liver gDNAs was isolated using the TIANamp blood DNA kit (TIANGEN Biotech, DP304-02) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Patricia Gallego Delgado, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Rats were anaesthetised (2% isoflurane; Abbott Laboratories ...