1 - 50 of 522
suppliers found for
RapidClean Protein Removal kit
» view 10000+ matched products-
Advansta Corporation Sponsored
With the RapidClean protein removal kit, completely remove protein from aqueous solutions of...Cat# K-01001-010, 10 reactions, USD $145.00/ea Ask
-
Illumina
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... before rRNA Removal with Ribo-Zero Gold rRNA Removal Kit (Illumina). 15ng of the rRNA-depleted RNA was used for sequencing library construction ... -
Miltenyi Biotec
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... following manufacturer instructions (Dead cell removal kit; Debris removal kit; Miltenyi Biotec) resulting in ~80% of purity and CD3+ T cells were resuspended in 1X PBS with 0.04% BSA ... -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... followed by DNA Removal using DNA-free™ DNA Removal Kit (Thermo Fisher) and subsequent reverse transcription using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher) ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Genomics 2020Quote: ... or QIAquick Nucleotide Removal Kit (QIAGEN). The purified DNA was eluted in H2O and used in the TET reaction. -
Lucigen
No products found because this supplier's products are not listed.bioRxiv - Systems Biology 2022Quote: ... the ribosomal RNA was depleted by Epicentre Ribo-zero® rRNA Removal Kit (Epicentre). Second ... -
Zymo Research
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2021Quote: ... and Zymo OneStep PCR Inhibitor Removal Kit (D6030, Zymo) to obtain high quality genomic DNA ... -
GenScript
No products found because this supplier's products are not listed.Cited in Pathologic α-Synuclein Species Activate LRRK2 in Pro-Inflammatory Monocyte and Macrophage ResponsesbioRxiv - Neuroscience 2020Quote: ... Purified monomer protein passed through two to three rounds of endotoxin removal (Endotoxin removal kit, GenScript) to reach a level of <0.1 EU mg-1 ... -
New England Biolabs
No products found because this supplier's products are not listed.Cited in DNA-PKcs promotes DNA end processingbioRxiv - Molecular Biology 2018, published in Science Advances doi: 10.1126/sciadv.aay0922Quote: ... and purified (NEB Nucleotide Removal Kit). The 197 bp DNA substrate labeled on the 5′ end was created by PCR using 5’ [32P] radiolabeled TP542 (GGTTTTCCCAGTCACGACGTTG ... -
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2018Quote: ... The removal of 6xHis tag was performed using Thrombin CleanCleave Kit (Sigma) and verified via immunoblot using anti-His antibody. -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019Quote: ... prior to removal of lipid and other contaminants using the ReadyPrep 2D cleanup Kit (Biorad, 1632130). Samples were then subjected to reduction ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... and rRNA removal was evaluated using the Bioanalyzer RNA Pico Kit (Agilent, Santa Clara, CA, USA). Strand-specific ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... and the RiboGone Low-Input Ribosomal RNA Removal Kit (Clontech). Library concentrations were measured using a Qubit 2.0 and library fragment sizes were measured using a Caliper Life Sciences LabChip GX ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2022Quote: ... The cells were collected after an additional two days and pelleted for dead cell removal based on Annexin V using the Dead Cell Removal (Annexin V) Kit (STEMCELL Technologies, #17899). -
Merck
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2022Quote: ... samples (100 µl culture broth) were subjected to protein precipitation followed by phospholipid removal (HybridSPE, Merck/Sigma Aldrich). The internal standard E2-d5 (Chromsystems ... -
Solarbio
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2022Quote: ... and Red Cell Removal kit (Solarbio; R1010). The final cells were re-suspended in 1×DPBS containing 0.04% BSA and prepared for further steps. -
Macherey-Nagel GmbH
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2022Quote: ... Mini kit for RNA purification with DNA removal column (Macherey-Nagel, cat# 740984.50). cDNA synthesis was performed using EvoScript Universal cDNA Master (Roche ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020, published in eLife doi: 10.7554/eLife.59839Quote: ... Proteoliposomes were formed by applying the lipid/protein containing sample (500 μl total volume) to an 18 ml detergent-removal column (Sephadex G-50 fine beads, GE Healthcare Life Sciences). Turbid fractions containing proteoliposomes were pooled ... -
Promega
No products found because this supplier's products are not listed.Cited in Transcriptomes and Raman spectra are linked linearly through a shared low-dimensional subspacebioRxiv - Systems Biology 2017, published in Cell Systems doi: 10.1016/j.cels.2018.05.015Quote: ... followed by a DNA removal (RQ1 DNase, Promega) and a ribosome RNA removal by the Ribo-Zero Gold rRNA Removal kit for yeast (Illumina Inc.) ... -
LI-COR
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... Total protein staining solution (REVERT Total Protein Stain kit, LI-COR Inc. ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2018, published in EBioMedicine doi: 10.1016/j.ebiom.2018.11.016Quote: ... The total protein concentration was determined by using Bradford protein assay kit (Abcam) and the collagen content of each sample was normalized to total protein. -
Avidity
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2022Quote: ... the proteins were biotinylated using the BirA biotin-protein ligase reaction kit (Avidity, #BirA500). Biotinylation of the NiV protein probes was confirmed by biolayer interferometry by testing the ability of the biotinylated protein to bind to streptavidin sensors ... -
NanoTemper
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: Proteins were labeled using the Monolith NT Protein Labeling Kit RED (NanoTemper Technologies) according to the manufacturer’s protocol and using a buffer consisting of 20 mM HEPES ... -
Biovision
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: EZClick global protein synthesis kit (Biovision) was used to detect nascent protein synthesis following manufacturer’s protocol ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Genomics 2021Quote: ... RNA-seq libraries were constructed with removal of ribosomal RNA using the KAPA Stranded RNA-Seq kit with RiboErase (Roche). The RNA extraction and library preparation were performed by the same technician to minimize confounding effects ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Physiology 2021Quote: ... After removal of doublets(BD™algorithm104) and normalization of cell number across samples ... -
Expedeon
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2022Quote: FASP Protein Digestion Kit (Expedeon, UK) was used in the sample preparation process ... -
R&D Systems
No products found because this supplier's products are not listed.Cited in The combined action of CTCF and its testis-specific paralog BORIS is essential for spermatogenesisbioRxiv - Genomics 2021Quote: ... Kit protein was detected with 1:2000 anti c-kit (AF1356 R&D Systems) and 1:2000 of anti-goat secondary antibody (sc2020 ... -
Protein Simple
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... Protein was detected using the anti-rabbit detection kit (#DM-001, Protein Simple). Protein was quantified by area under the curve of the chemiluminescent signal ... -
G-Biosciences
No products found because this supplier's products are not listed.bioRxiv - Physiology 2022Quote: ... Roche/Sigma-Aldrich)] and protein concentration was determined using CB-X Protein Assay kit (G-Bioscience, St. Louis, MO). After trypsination ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Genomics 2018, published in Applied and Environmental Microbiology doi: 10.1128/aem.02050-18Quote: Removal of Rat FABP1 gene from pTrc99A (AddGene) removed some cut sites from the MCS ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2022Quote: ... Target proteins were detected with the ABC Kit and the DAB kit (Vector Laboratories). -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2017, published in Nature Communications doi: 10.1038/s41467-017-00909-6Quote: ... treated with mycoplasma removal agent (MP Biomedicals), and monthly tested for mycoplasma before use. -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... Proteins were precipitated with the ProteoExtract Protein Precipitation Kit (Calbiochem) and quantified by Coomassie (Bradford ... -
Eppendorf
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2019Quote: ... The removal of AB was measured with the UV spectra (BioSpectrometer, Eppendorf) at 526 λ nm. -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... Protein content was determined using a Protein Determination Kit (Cayman Chemical, Cat# 704002) and absorbance was measured at 595 nm using a Nanodrop 2000 spectrophotometer (Thermofisher ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.Cited in Activity of the GHRH Antagonist MIA602 and its Underlying Mechanisms of Action in sarcoidosisbioRxiv - Immunology 2020Quote: ... Protein concentration was determined by BCA protein assay kit from Cell Signaling Technology. Thirty micrograms of total protein were mixed in a reducing sample buffer and used for mitochondrial apoptosis assay per the kit instruction ... -
Active Motif
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: Nuclear proteins were isolated from challenged A549 cells using a nuclear protein extraction kit (Active Motif) according to manufacturer’s specifications and protein concentration was determined using a bicinchoninic acid (BCA ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2021Quote: ... Animals were subjected to hair removal and fluorescence imaging (IVIS Lumina Series III, Perkin Elmer, USA) of the abdominal region at 0 (before treatment) ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... Erythrocyte removal was performed using RBC Lysis Buffer (BioLegend) for 5 minutes at room temperature ... -
Sartorius
No products found because this supplier's products are not listed.Cited in Local states of chromatin compaction at transcription start sites control transcription levelsbioRxiv - Molecular Biology 2019Quote: ... After removal of the debris using a Vivaclear Mini column (Sartorius), the cell extract ... -
Beckman
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... After removal of free adaptors using Agencourt magnetic beads (Beckman Coulter, USA), the libraries were PCR-amplified for 12 cycles using primers compatible Illumina dual-index sequences ... -
Santa Cruz
No products found because this supplier's products are not listed.Cited in miR-206 inhibits estrogen-induced proliferation and invasion of ER-α36 positive gastric cancer cellsbioRxiv - Cancer Biology 2021Quote: ... The protein concentration was obtained with Bicinchoninic Acid (BCA) Protein Assay Kit (Santa Cruz Biotechnology, Inc., Dallas, TX USA). For Western blot analysis ... -
ChromoTek
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2022Quote: ... Immunoprecipitation was performed using the protein lysates and a GFP-Trap_A Kit (Chromotek) following the manufacturer’s instructions ... -
Cytoskeleton
No products found because this supplier's products are not listed.bioRxiv - Genetics 2018, published in PLOS Genetics doi: 10.1371/journal.pgen.1007671Quote: ... recombinant proteins to a proprietary Ral effector protein was assessed using the RalA G-LISA™ Activation Assay Kit (#BK129, Cytoskeleton, Inc. Denver, CO), as per the manufacturer’s protocol ... -
Applied Biological Materials
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...Cat# G628, 100 Rxns/kit, please contact supplier for pricing. AskbioRxiv - Microbiology 2020Quote: ... Approximately 2 ug of RNA was treated with an AccuRT Genomic DNA Removal Kit (Applied Biological Materials, Richmond, BC, Canada) prior to cDNA synthesis using the 5X All-In-One Master mix (Applied Biological Materials) ... -
Boster
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... BCA protein assay kit (Boster, China) was used to measure the protein concentrations ... -
Cell Biolabs
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2022Quote: Protein carbonyls were visualized using the OxiSelect™ Protein Carbonyl Immunoblot Kit (Cell Biolabs). Tnrf1-/- BMDMs were seeded in 24-well plates at 2.5×105 one day prior to infection with indicated L ... -
Sino Biological
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: The concentration of the S protein was determined with an ELISA kit (SARS-CoV-2 Spike ELISA kit, Sino Biological Inc., Beijing, China). A monoclonal antibody specific for the S protein of SARS-CoV-2 was pre-coated onto well plates ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2022Quote: ... protein concentrations were measured using a Bradford kit (VWR). The lysate and supernatant samples were mixed with 1x Laemmli buffer with 1.5% 2-mercaptoethanol and were denatured at 95 ºC for 5 min ... -
PNA Bio
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... Cas9 protein (PNA bio) and gRNA were incubated at room temperature for 15 min in a 3:1 reaction with 15μg Cas9 and 5000 ng gRNA (2500ng of sgRNA#1 and 2500ng of sgRNA#2).47 The incubation product (gRNA and Cas9 complex ...