-
No products found
because this supplier's products are not listed.
Joana Enes, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and rabbit anti-S100 calcium-binding protein B β-subunit (S100-β) polyclonal antibody (Agilent Dako ...
-
No products found
because this supplier's products are not listed.
Yutian Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... S100 calcium binding protein B (S100B, 1:200; Abcam Cat# ab52642) and myelin protein zero (MPZ ...
-
No products found
because this supplier's products are not listed.
M. Eugenia Dieterle, et al.,
bioRxiv - Microbiology 2020
Quote:
High-protein binding 96-well ELISA plates (Corning) coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad ...
-
No products found
because this supplier's products are not listed.
Joseph C. Maggiore, et al.,
bioRxiv - Bioengineering 2020
Quote:
... rabbit anti-S100 Protein Ab-2 (S100, 1:500, Thermo Scientific Cat# RB-044-A) was used to identify Schwann cells ...
-
No products found
because this supplier's products are not listed.
M Koehl, E Ladevèze, M Montcouquiol, DN Abrous,
bioRxiv - Neuroscience 2021
Quote:
... and rabbit anti-S100 (1/1000, Sigma) antibodies in PBS-Triton-X-100 ...
-
No products found
because this supplier's products are not listed.
Silvio Schmidt, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the S100 calcium-binding protein B (S100B; rabbit, Synaptic system), and BrdU (mice ...
-
No products found
because this supplier's products are not listed.
Vedita Anand Singh, et al.,
bioRxiv - Molecular Biology 2023
Quote:
High protein binding 96-well ELISA plate (Greiner bio-one, USA) was coated with 1 µg/well of RBD protein (home-made ...
-
No products found
because this supplier's products are not listed.
Leila B. Giron, et al.,
bioRxiv - Microbiology 2022
Quote:
... and LPS Binding Protein (LBP) were quantified using DuoSet ELISA kits (R&D Systems; catalog # DY383-05 ...
-
No products found
because this supplier's products are not listed.
Kevin R. Bewley, et al.,
bioRxiv - Pathology 2020
Quote:
... high protein binding ELISA plates (PerkinElmer) were coated overnight at 4°C with rabbit anti-human IgG (Jackson Laboratories ...
-
No products found
because this supplier's products are not listed.
Arun Kumar Somavarapu, et al.,
bioRxiv - Biophysics 2022
Quote:
... 1 mM A6-A10 (Merck) for 30 min at 37℃ (see Table 2 for details on the compounds) ...
-
No products found
because this supplier's products are not listed.
Arpan Acharya, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... The protein was purified using a S100 column (GE Healthcare) equilibrated in 10 mM HEPES pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Mafalda Cacciottolo, et al.,
bioRxiv - Immunology 2023
Quote:
... Nucleocapsid level on exosomes was measured by ELISA using precoated ELISA plates (Legend Max SARS-CoV2 Nucleocapsid protein ELISA Kit, 448007, BioLegend) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Linghua Zhang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Rabbit anti-S100 1:200 (ProteinTech, 15146-1-AP), Rabbit anti-PGP9.5 1:1000 (MilliporeSigma ...
-
No products found
because this supplier's products are not listed.
Juliana M Rosa, et al.,
bioRxiv - Neuroscience 2021
Quote:
S100-β levels were measured in plasma using a specific ELISA kit (MyBioSource, catalog MBS2500369) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Pil Jung Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and rabbit monoclonal anti-calmodulin binding protein (Upstate Cell Signaling Solutions ...
-
No products found
because this supplier's products are not listed.
Dick J.H. van den Boomen, et al.,
bioRxiv - Cell Biology 2019
Quote:
... mouse anti-HMGCS1 (A6, Santa Cruz, #sc-166763), mouse anti-HMGCR (C1 ...
-
No products found
because this supplier's products are not listed.
María Florencia Pignataro, et al.,
bioRxiv - Biochemistry 2022
Quote:
... The binding to protein G magnetic beads (Biorad) was performed for 1 hour at 4 ºC (with previous washes with a RIPA buffer) ...
-
No products found
because this supplier's products are not listed.
Susanne Rauch, et al.,
bioRxiv - Immunology 2021
Quote:
... Mouse Il-5 Flex Set RUO (A6) (BD Bioscience, Cat. 558302); Mouse IL-6 Flex Set RUO (B4 ...
-
No products found
because this supplier's products are not listed.
Paweł Kozielewicz, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... Protein-low binding tubes (Eppendorf) were used to make serial dilutions of BODIPY-cyclopamine.
-
No products found
because this supplier's products are not listed.
Eraj Shafiq Khokhar, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Calcium phosphate transfection kit (Takara) was used for transfection ...
-
No products found
because this supplier's products are not listed.
Tyler B. Waltz, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Depletion of p11 from the media was confirmed using Rat S100 Calcium Binding Protein A10 (S100A10) ELISA Kit (Biomatik, Cat# EKN48271-96T) as per the attached instructions.
-
No products found
because this supplier's products are not listed.
Celine Santiago, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rabbit anti-S100 Beta (VWR/Protein Tech #15146-1-AP, 1:300), mouse anti-NeuN (Sigma # MAB377 ...
-
No products found
because this supplier's products are not listed.
Takafumi Nishida, et al.,
bioRxiv - Physiology 2023
Quote:
... anti-rabbit anti-sterol regulatory element-binding protein-2 (SREBP2, Cayman chemical, MI), anti PCSK9 (Cayman chemical) ...
-
No products found
because this supplier's products are not listed.
Hiroyasu Aoki, et al.,
bioRxiv - Immunology 2023
Quote:
... and RayBio COVID-19 N protein Human IgG ELISA Kit (RayBiotech) per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Raquel Guillamat-Prats, et al.,
bioRxiv - Immunology 2021
Quote:
... Calcium 5 Assay Kit (Molecular devices) for 1 h at 37° C ...
-
No products found
because this supplier's products are not listed.
Marek Petráš, et al.,
bioRxiv - Microbiology 2020
Quote:
The concentration of the S protein was determined with an ELISA kit (SARS-CoV-2 Spike ELISA kit, Sino Biological Inc., Beijing, China). A monoclonal antibody specific for the S protein of SARS-CoV-2 was pre-coated onto well plates ...
-
No products found
because this supplier's products are not listed.
Timothy M. O’Shea, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rabbit anti-S100a6 (1:200, A3461; Abclonal); goat anti-Serpina3n (1:200 ...
-
No products found
because this supplier's products are not listed.
Milou E. Noltes, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Medium calcium content was measured by photometrical absorption measurement of calcium EDTA complex using a Calcium Gen.2 kit (Roche, Germany). After 7 days ...
-
No products found
because this supplier's products are not listed.
Qingwen Qian, et al.,
bioRxiv - Physiology 2022
Quote:
... Levels of TSH and GH were determined by enzyme-linked immunoassay (ELISA) using commercially available ELISA kits (TSH ELISA kit, G-Biosciences, Cat No. IT6045; GH ELISA kit, Crystal Chem, Cat No. 80587) respectively according to manuals ...
-
No products found
because this supplier's products are not listed.
Stephanie Sibinelli de Sousa, et al.,
bioRxiv - Microbiology 2020
Quote:
... anti-maltose binding protein (MPB) (New England BioLabs #E8032L) and anti-outer membrane protein (OmpA ...
-
No products found
because this supplier's products are not listed.
Tshegofatso Ngwaga, et al.,
bioRxiv - Microbiology 2023
Quote:
Protein carbonyls were quantified using the OxiSelect Protein Carbonyl ELISA Kit (Cell Biolabs) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Laura Bricio Moreno, et al.,
bioRxiv - Immunology 2023
Quote:
... Recombinant protein was purified by binding to Ni-NTA beads (Qiagen) and eluted in the same buffer supplemented with 300 mM imidazole ...
-
No products found
because this supplier's products are not listed.
Hideo Hagihara, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The binding proteins were eluted by trypsin (Promega Corporation, Madison, WI, USA) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Sandra D. Chanez-Paredes, et al.,
bioRxiv - Cell Biology 2023
Quote:
Actin binding and polymerization were assessed using the actin binding protein kit (Cytoskeleton, BK013). Actin pellet gel bands were quantified by densitometry using FIJI.
-
No products found
because this supplier's products are not listed.
Aditya Kumar, et al.,
bioRxiv - Bioengineering 2022
Quote:
... ELISA was performed using the ELISA Starter Accessory Kit (Bethyl, E101) per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Huan Cao, et al.,
bioRxiv - Immunology 2020
Quote:
... in calcium binding buffer (10mM HEPES, 150mM NaCl2, 2.5mM CaCl2, pH 7.4) containing 1x Carbo-Free Blocking Solution (Vector Laboratories, SP-5040) and protease inhibitor cocktail (11836145001 ...
-
No products found
because this supplier's products are not listed.
Sonwabile Dzanibe, et al.,
bioRxiv - Immunology 2021
Quote:
... 15 and 36 weeks of age were used to measure the concentration of intestinal fatty-acid binding protein (iFABP) using a commercial ELISA kit (Elabscience). Test samples were diluted 1/400 in assay diluent and measured in duplicates according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Suhas Sureshchandra, et al.,
bioRxiv - Immunology 2021
Quote:
RBD and NP end-point titers were determined using standard ELISA and plates coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) or 1ug/mL SARS-CoV-2 nucleocapsid protein (NP) ...
-
No products found
because this supplier's products are not listed.
Majid Mehravar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 220 μL Binding Buffer (from Zymo Kit) was used ...
-
No products found
because this supplier's products are not listed.
Zeenat A. Shyr, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and proinsulin ELISA kit (Mercodia, Uppsala, Sweden) respectively from batches of ten size-matched islets after acid-ethanol extraction [12].
-
No products found
because this supplier's products are not listed.
Sasha Reschechtko, et al.,
bioRxiv - Physiology 2022
Quote:
... The ELISA kits (ALPCO, Salem, NH, USA) we used to measure plasma progesterone concentrations have a sensitivity of 0.32 nmol/L and a range up to 191 nmol/L.
-
No products found
because this supplier's products are not listed.
Kazuhiro Hayashi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... ELISA kits (Mouse BDNF ELISA Kit PicoKine™ EK0309)(Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Feng Chen, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... TNF-α protein level was measured by using an ELISA kit from PeproTech (#900-K25) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sang-Ho Kang, et al.,
bioRxiv - Plant Biology 2019
Quote:
... The DNA/Polymerase Binding Kit P6 (PacBio) was used for DNA synthesis after the sequencing primer annealed to the SMRTbell template ...
-
No products found
because this supplier's products are not listed.
Emma S. Noel, et al.,
bioRxiv - Neuroscience 2024
Quote:
... A corticosterone ELISA kit (Enzo Life Sciences) was used to quantify corticosterone levels in blood serum samples ...
-
No products found
because this supplier's products are not listed.
Jack Polmear, et al.,
bioRxiv - Immunology 2023
Quote:
96-well high-binding ELISA plates (Sarstedt) were coated overnight at 4°C with either goat anti-mouse IgA ...
-
No products found
because this supplier's products are not listed.
Jean-Philippe Guégan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The level of protein binding to DNA consensus sequence was then assessed by ELISA using the TransAM NF-kB Family kit (Active Motif) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Lisa Pomeranz, et al.,
bioRxiv - Bioengineering 2023
Quote:
... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
No products found
because this supplier's products are not listed.
Acharya Balkrishna, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... CB-Protein Assay kit and MCP-1 ELISA kit from G-Biosciences, India ...
-
No products found
because this supplier's products are not listed.
Xiaoning Gao, et al.,
bioRxiv - Cell Biology 2024
Quote:
... ELISA kits from Solarbio, catalogue numbers SEKR-0002 ...