-
No products found
because this supplier's products are not listed.
Minxiao Yang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Primary antibodies used for co-staining were rabbit-anti-Gramd2 (1:100, ATLAS biological, CAS #HPA 029435), rabbit-anti-Sftpc (1:300 ...
-
No products found
because this supplier's products are not listed.
Eun Hye Kim, et al.,
bioRxiv - Microbiology 2022
Quote:
... Cells were washed and stained with antibodies against cell surface molecules in PBS containing 4% of human serum (Valley Biomedical). NGFR was detected with a 20 μl per million cells of Alexa Flour 647 conjugated α-NGFR (BD Bioscience) ...
-
No products found
because this supplier's products are not listed.
Adriana C. Camarano, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... rabbit anti-TH (1:1000; 657012, Calbiotech); chicken anti-TH (1:1000 ...
-
No products found
because this supplier's products are not listed.
Rebecca Kochanowsky, et al.,
bioRxiv - Microbiology 2022
Quote:
... Anti-Myc antibody (Protein Mods, Madison WI, USA) was used at 1:5,000 and the detecting anti-mouse antibody (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Daniel Blumenthal, et al.,
bioRxiv - Immunology 2019
Quote:
Hydrogel surfaces spanning a stiffness range of 1 – 25 kPa were obtained from Matrigen. Hydrogel stiffness was verified by AFM at different locations around the hydrogel surface (Figure 2 - Figure Supplement 1) ...
-
No products found
because this supplier's products are not listed.
István Fodor, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2) incubation with a rabbit anti-ap-GnRH/CRZ antiserum (#AS203-2, EZbiolab; antigen was a synthetic undecapeptide ...
-
No products found
because this supplier's products are not listed.
Peter Radvak, et al.,
bioRxiv - Immunology 2021
Quote:
... Cutaneous temperature was also measured on mouse tail surface using a rodent infrared thermometer (Braintree Scientific) following infection ...
-
No products found
because this supplier's products are not listed.
Mikayla A Payant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... they were immediately incubated anti-rabbit MCH (1:2,000; RRID: AB_2314774) and anti-mouse NeuN (1:1,000; HB6429, Hello Bio, Princeton, NJ) in NDS overnight (RT) ...
-
No products found
because this supplier's products are not listed.
LE. Carter, et al.,
bioRxiv - Cell Biology 2020
Quote:
... hOSE cells were scraped from the ovarian surface and isolated by centrifugation in hOSE media (Wisent Bioproducts) supplemented with 10% FBS ...
-
No products found
because this supplier's products are not listed.
Chao Li, et al.,
bioRxiv - Biophysics 2024
Quote:
... Plasma Surface Technology) at 100 W for 3 min and then moved to a vacuum desiccator (Bel-Art F420220000 ...
-
No products found
because this supplier's products are not listed.
Arshed Nazmi, et al.,
bioRxiv - Neuroscience 2021
Quote:
... of lidocaine along upper surface of the head and connected to a pulse oximeter (MouseSTAT® Jr., Kent Scientific). Under sterile conditions ...
-
No products found
because this supplier's products are not listed.
Jacob Golan, et al.,
bioRxiv - Microbiology 2023
Quote:
... concentrated conidial suspension onto the upper surface of a sterile 19×19 mm ultra-thin (0.25mm) quartz cover slip (Chemglass Life Sciences ...
-
No products found
because this supplier's products are not listed.
Tessa Acar, et al.,
bioRxiv - Microbiology 2021
Quote:
Explants were surface sterilized by submerging them in a 5% solution of Plant Preservative Mixture (PPM, Plant Cell Technology, USA) with shaking at 100 rpm for 8hrs at 28°C ...
-
No products found
because this supplier's products are not listed.
Martin Joseph Lett, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Images for protein expression and surface labeling were acquired on an inverted spinning-disk confocal microscope (Nikon Ti2 equipped with a Photometrics Kinetix 25mm back-illuminated sCMOS ...
-
No products found
because this supplier's products are not listed.
Karen Mruk, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... a plate containing E3 medium and embryos was mounted onto a mirrored surface and then fixed onto a Vortex-Genie (Scientific Industries). Dechorionated embryos were irradiated using a blue LED light source (TaoTronics) ...
-
No products found
because this supplier's products are not listed.
Mitsuhiro Abe, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The cells were washed and incubated with HMSiR-coupled goat anti-rabbit IgG (#A204-01, GORYO Chemical, Inc.).
-
No products found
because this supplier's products are not listed.
Fernando Janczur Velloso, et al.,
bioRxiv - Neuroscience 2021
Quote:
... the mice were placed on the surface (30cm × 30cm) of a digitally controlled hot plate (model I-39, Campden Instruments, Loughborough, England), heated to a maximum temperature of 55°C ...
-
No products found
because this supplier's products are not listed.
Alexander O. Bradley, et al.,
bioRxiv - Biochemistry 2019
Quote:
Coverslips were prepared and functionalized with polyethylene glycol (final surface composition, 97% methoxy-PEG and 3% biotin-PEG; JenKem Technology, Allen, TX) as previously described (Bor et al. ...
-
No products found
because this supplier's products are not listed.
Rocío del M. Saavedra-Peña, et al.,
bioRxiv - Physiology 2022
Quote:
... Cells were then stained with anti-BrdU antibody (Alexa Fluor 647; Phoenix Flow Systems; AX647) at 1:30 in HBSS with 3% BSA overnight in the dark at 4C ...
-
No products found
because this supplier's products are not listed.
Dara Bree, et al.,
bioRxiv - Neuroscience 2019
Quote:
... a 96-well plate was coated with a mouse anti-CGRP capture antibody (Bertin Bioreagent) and incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Kelsey Cremin, et al.,
bioRxiv - Microbiology 2020
Quote:
... or < 0.5 mm agarose gels were deposited on the glass surface of a 50 mm glass bottomed dish (WillCo Wells, USA, HBST-5040). A 100 μL aliquot of an overnight culture (optical density at 600 nm ~ 0.45 ...
-
No products found
because this supplier's products are not listed.
Frank Hay, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Two hundred seeds per seedlot were placed (without surface-sterilization) on 2% water agar (20 g/liter agar; Hardy Diagnostics, Santa Maria, CA) + 0.2 g/liter ampicillin ...
-
No products found
because this supplier's products are not listed.
Laura Frohn, et al.,
bioRxiv - Physiology 2023
Quote:
... Samples were then incubated with 100 µL of anti-rainbow-trout IgM monoclonal antibody (Aquatic Diagnostic Ltd. ...
-
No products found
because this supplier's products are not listed.
Michael G. LaMontagne, et al.,
bioRxiv - Microbiology 2022
Quote:
... Temperature and dissolved oxygen were measured in situ at 3 – 5 cm beneath the surface with a YSI model 55 dissolved oxygen (DO) probe (YSI Inc., Young Spring, OH). Water samples were split in the field for FIB (E ...
-
No products found
because this supplier's products are not listed.
Maryam Hajfathalian, et al.,
bioRxiv - Bioengineering 2023
Quote:
... mutans biofilms were formed on saliva-coated hydroxyapatite (sHA) discs with surface area of 2.7 ± 0.2 cm2 (Clarkson Chromatography Products Inc., South Williamsport, PA), as described previously (85) ...
-
No products found
because this supplier's products are not listed.
Tomozumi Imamichi, et al.,
bioRxiv - Microbiology 2022
Quote:
... and anti-protease antibody (Cat# ab211627 Abcam, Cat# SKU: 65-018, As One International, Santa Clara, CA, USA), Protein bands were detected by using the ECL Prime Western Blotting Detection Reagent (MiliporeSigma ...
-
No products found
because this supplier's products are not listed.
Alisa Fox, et al.,
bioRxiv - Immunology 2021
Quote:
... cells were washed and incubated in Accutase cell detachment solution for 10 min at room temperature to gently remove any surface-bound virus while preserving epitopes for flow cytometry analysis (Innovative Cell Technologies; as described in (39)) ...
-
No products found
because this supplier's products are not listed.
Jasmine Alexander-Floyd, et al.,
bioRxiv - Immunology 2021
Quote:
... supernatants and recombinant cytokine standards were applied to anti-IL-1β antibody-coated (eBioscience) Immulon ELISA plates (ImmunoChemistry Technologies). IL-1β was detected using biotinylated anti IL-1β (eBioscience ...
-
No products found
because this supplier's products are not listed.
Sylvain Perriot, et al.,
bioRxiv - Immunology 2024
Quote:
... transfected Jurkat cells and co-culture with HLA-unenhanced neurons or in presence of a blocking anti-HLA ABC antibody (W6/32, AffinityImmuno). Luminescence was measured with a Multimode Microplate Reader (BioTek Synergy) ...
-
No products found
because this supplier's products are not listed.
Latha Muniappan, et al.,
bioRxiv - Pathology 2020
Quote:
Calpain-2 immunostaining was performed using a rabbit anti-human calpain-2 (10 µg/ml, catalog No. RP-3 Calpain-2; Triple Point biologics, Forest Grove, OR). CD68 immunostaining was performed using a rabbit anti-human CD68 antibody (1:200 ...
-
No products found
because this supplier's products are not listed.
Anne Slavotinek, et al.,
bioRxiv - Genetics 2020
Quote:
... Neomycin phosphotransferase II (NPTII) expressed from NeoR cassette on pcDNA3-Exosc5 vectors was detected with anti-NPTII monoclonal antibody (1:1000; Cell Applications, Inc.). Primary antibodies were detected using goat secondary antibodies coupled to horseradish peroxidase (1:3000 ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... HRP-human IgG antibody (EY Laboratories, USA), and BT IgE antibody (Bio-Rad Laboratories ...
-
No products found
because this supplier's products are not listed.
Giovannino Silvestri, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... anti-SET (Globozymes); anti-ABL (Ab-3) ...
-
No products found
because this supplier's products are not listed.
Takeshi Katsuda, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 1× antibiotics (anti-anti (Thermo) or gentamycin (Gemini Bio-Products)) ...
-
No products found
because this supplier's products are not listed.
Olivia M. S. Carmo, et al.,
bioRxiv - Biochemistry 2021
Quote:
... rabbit α0801 (1:1000, gift from T. de Koning Ward and P. Gilson [9]), rabbit αMESA (1:1000 ...
-
No products found
because this supplier's products are not listed.
Sanne van der Niet, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Dihydrochloride) detection was performed using anti dinitrophenol (DNP) (Polyclonal Anti-DNP, Oxford Biomedical Research). All antibodies were diluted in 1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Katrina Mekhail, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-C9 agarose bead (Cube Biotech), HA antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
M. Julhasur Rahman, et al.,
bioRxiv - Microbiology 2021
Quote:
... the RK13 cells we used were confirmed to be of European rabbit (Oryctolagus cuniculus) origin by PacBio sequencing (ArrayExpress accession ...
-
No products found
because this supplier's products are not listed.
Renee C. Geck, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Antibodies were used at indicated dilutions in 5% milk (Andwin Scientific) in TBST buffer (Boston Bioproducts) ...
-
No products found
because this supplier's products are not listed.
Hongbing Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
The E-ALPHA® human scFv antibody phage display libraries (Eureka Therapeutics) were used for the selection of human antibody constructs specific to SARS-CoV-2 spike protein ...
-
No products found
because this supplier's products are not listed.
Yuichi Tsuchiya, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The messenger RNA was purified from the total RNA of the spleen and bone marrow cells of immunized rabbits using the NucleoTrap mRNA kit (Macherey-Nagel, 740655) and according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
Branislav Kovacech, et al.,
bioRxiv - Microbiology 2021
Quote:
... Binding of HRP-conjugated RBD to immobilized antibody 1 was detected with TMB one substrate (Kementec Solutions A/S, Demark) and stopped with 50 μl of 0.25 M H2SO4 ...
-
No products found
because this supplier's products are not listed.
Yeon-Jee Kahm, Uhee Jung, Rae-Kwon Kim,
bioRxiv - Cancer Biology 2023
Quote:
... cells were incubated with antibodies in a solution of Tris-buffered saline (cat. no. A0027, BIO BASIC, Markham ON, Canada) at 4°C for overnight ...
-
No products found
because this supplier's products are not listed.
João L. Pereira, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Tris-buffered saline with 0.1% Tween 20 was used for washing and antibody incubation as well as membrane blocking with 5% bovine serum albumin (cat. no. MB04602, NZYTech). The chemiluminescent signals were acquired by incubating the membrane with SuperSignal West Femto Maximum Sensitivity Substrate (cat ...
-
No products found
because this supplier's products are not listed.
Irmgard U. Haussmann, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...
-
Recombinant Rabbit BCMA Protein, fused to His tag, was expressed in HEK293.
Cat# TNFRSF17-02R,
10ug , USD $198
Ask
Yan Qi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the presence of anti- Ad and anti-hemagglutinin antibodies was measured by ELISA against a purified Ad6 virus preparation (Greffex, Inc.) and a recombinant hemagglutinin protein (Creative Biomart). In the first case ...
-
No products found
because this supplier's products are not listed.
Grzegorz Maciag, et al.,
bioRxiv - Cell Biology 2024
Quote:
... After antibody staining the tissue was washed 6 times in PBS and before imaging the tissue was incubated in RapiClear (SUNJin Lab) for 30-60 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
Thrombin anti-thrombin complexes in septic plasma were measured using commercially available ELISA kits (AssayPro; EMT1020-1) according to manufacturers’ instructions ...
-
No products found
because this supplier's products are not listed.
Chongkai Zhai, et al.,
bioRxiv - Microbiology 2021
Quote:
... The D-dimer and FDPs concentrations of serum samples were determined by the double antibody sandwich method using mouse D-dimer and mouse FDPs ELISA kits (Sunlong Biotech, Hangzhou, Zhejiang, China) as described previously [44] ...