-
No products found
because this supplier's products are not listed.
Stefan Zdraljevic, et al.,
bioRxiv - Genetics 2019
Quote:
... two master mixes were prepared: a) LT-1 transfection reagent (Mirus) was diluted 1:10 in Opti-MEM and incubated for five minutes ...
-
No products found
because this supplier's products are not listed.
Andrea S. Baez-Gonzalez, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Quantitative RT-PCR (qPCR) was performed with FastSYBR mixture (CoWin Biosciences) on the AriaMx Real-Time PCR System (Agilent Technologies ...
-
No products found
because this supplier's products are not listed.
Coralie Dessauges, et al.,
bioRxiv - Systems Biology 2022
Quote:
... The following primers were used for the RT-qPCR reaction (designed with the Real-time PCR (TaqMan) Primer and Probes Design Tool from GenScript).
-
No products found
because this supplier's products are not listed.
Salman Tamaddon-Jahromi, et al.,
bioRxiv - Cell Biology 2023
Quote:
... expression was carried out in healthy and cancer ovarian tissues by RT-qPCR using Tissuescan™ ovarian cancer cDNA arrays I-IV (Origene Technologies, USA) and EFA6R (NM_206909.3 ...
-
No products found
because this supplier's products are not listed.
Anu Roy, et al.,
bioRxiv - Biochemistry 2022
Quote:
... RT in black 384 well plates (Corning 3575 plates), followed by addition of 50 nM of fluorescein labeled ADP-ribosylated peptide [5Flu-ARTKQTARK(Aoa-RADP)S] ...
-
No products found
because this supplier's products are not listed.
Michael Smith, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... with another RT inhibitor BPPA (Santa Cruz Biotechnology Inc., CA) that specifically inhibits the catalytic RT domain of human telomerase (hTERT).
-
No products found
because this supplier's products are not listed.
Mike R. Schlabach, et al.,
bioRxiv - Immunology 2023
Quote:
... Ribonucleoprotein (RNP) master mixes containing Cas9 protein (Aldevron, Cat#9212) and u728 sgRNA or a7mm OLF sgRNA were added to the cell suspension and transferred to processing assembly (MaxCyte) ...
-
No products found
because this supplier's products are not listed.
Christopher Wong, Elena M. Jurczak, Richard Roy,
bioRxiv - Developmental Biology 2023
Quote:
... The gene expression levels were determined by RT-qPCR using a 2x SyberGreen qPCR Master-mix (ZmTech Scientifique, Q2100N) and a Bio-Rad CFX384 Real-Time 96-well PCR qPCR Detection System (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Jimena Leyria, Ian Orchard, Angela B. Lange,
bioRxiv - Molecular Biology 2020
Quote:
... RT-qPCR was performed using an advanced master mix with super green low rox reagent (WISENT Bioproducts Inc, QC, Canada). Three independent experiment were performed (n=3 ...
-
No products found
because this supplier's products are not listed.
Arne L. ten Hoeve, et al.,
bioRxiv - Microbiology 2024
Quote:
... or HotStart™ 2X SYBR Green qPCR Master Mix (APExBIO Technology), specific forward and reverse primers at target-dependent concentrations (100-200 nM ...
-
No products found
because this supplier's products are not listed.
Yang Zhang, Jifeng Yuan,
bioRxiv - Synthetic Biology 2022
Quote:
... Realtime qPCR was carried out using Perfectstart SYBR Green qPCR Master Mix kit (Omega Bio-Tek, GA, USA) with a thermal cycler (Agilent AriaMx ...
-
No products found
because this supplier's products are not listed.
Jordan T. Becker, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Transfection mixes contained 1µg (24-well) or 333ng (IBIDI) total plasmid DNA ...
-
No products found
because this supplier's products are not listed.
Freddy Khayat, et al.,
bioRxiv - Genetics 2021
Quote:
... YNB and SC mixes were from United States Biological. For transformations ...
-
No products found
because this supplier's products are not listed.
Ana Martín-Leal, et al.,
bioRxiv - Immunology 2020
Quote:
... Quantitative RT-PCR was performed using FluoCycle II SYBR Master Mix (EuroClone) with specific primers (Supplementary Table S1 ...
-
No products found
because this supplier's products are not listed.
Robert Wiesheu, et al.,
bioRxiv - Immunology 2020
Quote:
... Lung digestion mixes were placed on gentleMACS Octo Dissociator (Miltenyi Biotec) with a heater and digested at 37°C using default programme 37C_m_LDK_01 ...
-
No products found
because this supplier's products are not listed.
Debatosh Das, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Real-time RT-PCR was performed with the qPCR GreenMaster high ROX mix (Jena Bioscience, Germany) and primers shown in Table S1 ...
-
No products found
because this supplier's products are not listed.
Yi-Nan Zhang, et al.,
bioRxiv - Microbiology 2022
Quote:
... and transfection mixes were incubated for up to 48 hours in six-well plates (Greiner). Following incubation ...
-
No products found
because this supplier's products are not listed.
Trupti Vardam-Kaur, et al.,
bioRxiv - Immunology 2021
Quote:
... The P14 cell/Cas9/RNP mixes were transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Cells were electroporated using a 4D nucleofector (4D-Nucleofector Core Unit ...
-
No products found
because this supplier's products are not listed.
Rebecca A. MacPherson, et al.,
bioRxiv - Genomics 2022
Quote:
We prepared libraries for RNA sequencing from each RNA sample used in the RT-qPCR analyses according to Universal RNA-Seq with NuQuant + UDI (Tecan Genomics, Inc., Redwood City, CA) manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Linda Scaramuzza, et al.,
bioRxiv - Neuroscience 2020
Quote:
... EXcellence RT software (Olympus) was used to set up experiments and samples’ recordings ...
-
No products found
because this supplier's products are not listed.
Helle Samdal, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... qPCR was performed using human positive and negative control qPCR primer sets from Active Motif (Supplementary Table S6). Furthermore ...
-
No products found
because this supplier's products are not listed.
Shirly Freilikhman, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... with PrimeTime Gene Expression Master Mix (IDT DNA) and the following primers ...
-
No products found
because this supplier's products are not listed.
Luis C. Santos, et al.,
bioRxiv - Cell Biology 2021
Quote:
mgWAT from RT or cold exposed mice (Jackson Laboratory, #000664) was fixed in 10% formalin overnight ...
-
No products found
because this supplier's products are not listed.
Favian A. Hatje, et al.,
bioRxiv - Cell Biology 2020
Quote:
... for 30 min at RT and cover-slipped with Fluoromount (SouthernBiotech). Paraffin sections (3 µm ...
-
No products found
because this supplier's products are not listed.
Jonnathan Singh Alvarado, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Master-8 (A.M.P.I.) and pClamp 10.2 software (Molecular Devices, Axon Instruments) controlled the photostimulation output.
-
No products found
because this supplier's products are not listed.
Junior J. West, Tony J. C. Harris,
bioRxiv - Developmental Biology 2020
Quote:
... at RT with a 63x Plan Apochromat NA 1.4 objective (Carl Zeiss, Inc.), a piezo top plate ...
-
No products found
because this supplier's products are not listed.
Katarzyna Seget-Trzensiok, et al.,
bioRxiv - Cell Biology 2020
Quote:
... incubated 1 h in RT with HRP-conjugated secondary antibodies (R&D Systems), and followed by rinsing 3x 5 minutes with TBS-T ...
-
No products found
because this supplier's products are not listed.
Anna-Leigh Brown, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and subsequently bead/size selection of RT/PCR products (TotalPure NGS, Omega Biotek). Three rounds of nested PCR using Phusion HF 2x Master Mix (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Hironori Abe, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... at RT for 30 min before incubation with anti-RNF8 antibody (Proteintech, 14112-1-AP), diluted 1/2000 in Tris-buffered saline containing 0.1% Tween 20 detergent (TBST) ...
-
No products found
because this supplier's products are not listed.
Cassandra Velasco, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PCR master mixes were decontaminated with double-stranded DNAse treatment (PCR decontamination kit, Arcticzymes, Tromsø, Norway). Sterile water was processed using the same procedure as a negative control ...
-
No products found
because this supplier's products are not listed.
Georg T. Wondrak, et al.,
bioRxiv - Microbiology 2021
Quote:
... RT-qPCR was carried out in a 20 µL reaction mixture with extracted RNA and One step RT-qPCR 2x Master Mix containing ROX as a passive reference dye (Gold Biotechnology, St. Louis, MO) and 300 nM forward and reverse primers and 200 nM MGB probe ...
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Chiara Cassioli, et al.,
bioRxiv - Immunology 2020
Quote:
... and analyzed by RT-qPCR on 96-well optical PCR plates (Sarstedt) using the SsoFast™ EvaGreen® Supermix (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Wei-chung Tsao, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Reaction mixes were freshly made with 20uM FAMazide (Lumiprobe B5130), 4mM copper sulfate pentahydrate (Sigma) ...
-
No products found
because this supplier's products are not listed.
Jorge Vera-Otarola, et al.,
bioRxiv - Microbiology 2022
Quote:
... Viral stock was confirmed by RT-qPCR (LightMix® SARS-CoV-2 RdRp-gene EAV PSR & Ctrl (TIB MOLBIOL). Reactions were run in a LightCycler® 480 real time-PCR system (Roche) ...
-
No products found
because this supplier's products are not listed.
Daniel Roderer, et al.,
bioRxiv - Molecular Biology 2019
Quote:
TcA (1 mg/ml) was mixed with different lipid mixes dissolved in 5% β-D-octylglucoside (Anatrace) with a total lipid concentration of 5 mg/ml ...
-
No products found
because this supplier's products are not listed.
Xiaodong Lu, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... QPCR was performed with 2xBullseye EvaGreen qPCR MasterMix (MIDSCI) and StepOne Plus (Applied Biosystems) ...
-
No products found
because this supplier's products are not listed.
Mai M. Abdelmoaty, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV-2 genome equivalents were quantified in culture supernatant by RT-qPCR using 2019-nCoV CDC probe and Primer Kit for SARS-CoV-2 (Biosearch Technologies, KIT-nCoV-PP1-1000). Forward primer ...
-
No products found
because this supplier's products are not listed.
Galen J. Correy, et al.,
bioRxiv - Biochemistry 2022
Quote:
... MicroRT tubing (Mitegen, RT-T1) with 5 μl of reservoir in the end was placed over the crystals to prevent dehydration ...
-
No products found
Sumit Handa, et al.,
bioRxiv - Biochemistry 2020
Quote:
Reverse transcription reactions with Moloney Murine Leukemia Virus (MMLV) RT (BioBharati Life Sciences Pvt. Ltd) and HIV RT (Worthington Biochemical) were carried out according to the manufacturer’s directions using primer P5 (Table S1) ...
-
No products found
because this supplier's products are not listed.
Jeong-Su Park, et al.,
bioRxiv - Immunology 2022
Quote:
... and reverse-transcribed using RT-Premix (Intron Biotechnology). PCR was performed with the following primers (the respective forward and reverse pairs are indicated) ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... 5 μl PPP Master Mix (Top-Bio) and 3 μl PCR H2O (Top-Bio) ...
-
No products found
because this supplier's products are not listed.
Zaghi Mattia, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 1× Titan HotTaq EvaGreen qPCR Mix (Bioatlas, Estonia), and 0.4 mM of each primer ...
-
No products found
because this supplier's products are not listed.
Abdelrahim Zoued, et al.,
bioRxiv - Microbiology 2021
Quote:
... for 1h at RT without agitation and observed by light microscopy (Nikon Ti Eclipse equipped with a metal-oxide-semiconductor (sCMOS ...
-
No products found
because this supplier's products are not listed.
Pastor Jullian Fabres, et al.,
bioRxiv - Plant Biology 2021
Quote:
... RT-PCR products were purified using PCR Clean-up (Macherey-Nagel, 740609.250) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Emily Lorenzen, et al.,
bioRxiv - Biochemistry 2019
Quote:
... cells were fixed for 10 mins at RT with 4% weight:volume FA (Polysciences, Inc) in 1x PBS ...
-
No products found
because this supplier's products are not listed.
Merrick Pierson Smela, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... Reporter lines were screened for common karyotypic abnormalities using a qPCR kit (Stemcell Technologies) followed by verification via Thermo Fisher Cell ID + Karyostat and Pluritest services ...
-
No products found
because this supplier's products are not listed.
Sang-Han Choi, et al.,
bioRxiv - Neuroscience 2024
Quote:
... controlled by a pulse generator (Master 9; World Precision Instruments, Sarasota, FL, USA).
-
No products found
because this supplier's products are not listed.
Christopher B. Mahony, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... blocked in 4% FBS for 20 mins at RT and stained with H2A.XS139ph (GeneTex, GTX127342) (diluted 1:1000 in 3% FCS/PBS ...
-
No products found
because this supplier's products are not listed.
Dennis J. Weingarten, et al.,
bioRxiv - Neuroscience 2021
Quote:
... then in primary antibody for 2 h at RT (rabbit anti-Syt3, 1:3000, Synaptic Systems 105133 ...