-
No products found
because this supplier's products are not listed.
Cristina Solana-Manrique, et al.,
bioRxiv - Neuroscience 2020
Quote:
... were performed with MTT (3-(4, 5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) (Sigma-Aldrich) as described in Sanz et al ...
-
No products found
because this supplier's products are not listed.
Francis Ledesma, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Amber N. Stratman, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
No products found
because this supplier's products are not listed.
Blair K.A. Willette, Nikoleta G. Tsvetanova,
bioRxiv - Cell Biology 2022
Quote:
... 8-(4-Chlorophenylthio)adenosine 3’,5’-cyclic monophosphate (8-CPT-cAMP) was purchased from Abcam (Cat #ab120424), dissolved in water to 150mM stock ...
-
No products found
because this supplier's products are not listed.
Liang Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
No products found
because this supplier's products are not listed.
Matilda Shackley, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 2-(4-chlorophenyl)-3-methyl-N-(thiazole-2-yl)butanamide (4-CMTB; Tocris) was used as a FFAR2-specific agonist and AR420626 (Cayman ...
-
No products found
because this supplier's products are not listed.
Konstadinos Moissoglu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Raed Ibraheim, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... After blocking with 5% Blocking-Grade Blocker solution (Bio-Rad) for 2 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Christine Krammer, et al.,
bioRxiv - Immunology 2021
Quote:
... 8 color (4-2-2) configuration (BD Bioscience, Heidelberg, Germany). The system automatically adjusts spillover values for the compensation of standard fluorochromes ...
-
No products found
because this supplier's products are not listed.
Elena Tomas Bort, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... followed by 3 PBS washes and blocking with 5% bovine serum albumin (BSA; Merck) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Qian Chen, et al.,
bioRxiv - Genomics 2020
Quote:
... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
No products found
because this supplier's products are not listed.
Dougald M. Monroe, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4 μM lipid vesicles (Avanti Polar Lipids PS:PC:PE 3:2:5), and FV (0 ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Angela B Schmider, et al.,
bioRxiv - Cell Biology 2019
Quote:
... (N-{(2S,4R)-4-(Biphenyl-2-ylmethyl-isobutyl-amino)-1-[2-(2,4-difluorobenzoyl)-benzoyl]-pyrrolidin-2-ylmethyl}8-3-(4-(2,4-dioxothiazoldin-5-ylidenemethyl)-phenyl]acrylamide (cPLA2 inhibitor, cPLA2 Inh, Calbiochem, EMD Biosciences), was used concomitantly with priming at 5 μM and MK-886 (FLAP Inh ...
-
No products found
because this supplier's products are not listed.
David Kabelik, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and pS6 blocking peptide (1220S, Cell Signaling Technology) antibody eliminated signal (Supplementary Fig ...
-
No products found
because this supplier's products are not listed.
Jun Muto, et al.,
bioRxiv - Cell Biology 2021
Quote:
... overnight at 4°C after blocking with blocking solution (S3022, Dako) for 30 min ...
-
No products found
because this supplier's products are not listed.
David Alcantara-Gonzalez, et al.,
bioRxiv - Neuroscience 2024
Quote:
... followed by incubation for 2 h in blocking solution containing 5% NGS (Vector Laboratories) and 1.5% Mouse-on-Mouse (MOM ...
-
No products found
because this supplier's products are not listed.
Toshiaki Mishima, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 14-3-3 (H-8; Santa Cruz Biotechnology), MARK3 (G-7 ...
-
No products found
because this supplier's products are not listed.
Alexia Polissidis, et al.,
bioRxiv - Neuroscience 2021
Quote:
For GBA quantification (n=5 for 4 WPI, n=3 for 8 WPI), the surface function of the Imaris software was used to select only GFP-positive cells by appropriately adjusting the number of voxels as well as the intensity of the GFP channel in the threshold tab ...
-
No products found
because this supplier's products are not listed.
Victoria A. Trinkaus, et al.,
bioRxiv - Cell Biology 2020
Quote:
... blocking solution consisting of 2 % BSA (Roth) and 4 % donkey serum (Jackson ImmunoResearch) in PBS was added for 30 min at RT ...
-
No products found
because this supplier's products are not listed.
Mikala C. Mueller, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and KCGPQGIWGQCK (MMP-2 degradable peptide; GenScript) were used as crosslinkers in a 70:30 molar ratio respectively and were dissolved in 15 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP ...
-
No products found
because this supplier's products are not listed.
Abhinav Sur, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Samples were blocked for 2 hours in blocking solution (5% Normal Donkey Serum (Jackson Labs), 10% Bovine Serum Albumin ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Ahmed A. Zarea, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... After blocking with 5% ECL Blocking Agent (GE Healthcare, RPN2125) at RT for 1 h ...
-
No products found
because this supplier's products are not listed.
Fábio J. Ferreira, et al.,
bioRxiv - Genetics 2023
Quote:
Cells were seeded 2-3 days before fixation in 8-well µ-slides (Ibidi) or 96-well CellCarrier Ultra microplates (PerkinElmer) ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Udita Chandola, et al.,
bioRxiv - Microbiology 2023
Quote:
... 4 °C) and the cells were resuspended in 5 mL of methanol/dichlormethane/ethylacetate 10:2:3 (dichlormethane: SupraSolv, VWR Chemicals ...
-
No products found
because this supplier's products are not listed.
Chong Wang, et al.,
bioRxiv - Genetics 2022
Quote:
... the pre-implantation embryos were harvested from 4-5-week-old C57BL/6N females mated with DBA/2 males (8-week-old when purchased from Charles River). To be specific ...
-
No products found
because this supplier's products are not listed.
M. Fernanda Palominos, et al.,
bioRxiv - Developmental Biology 2023
Quote:
2 and 8 dpf larvae were fixed in 4% paraformaldehyde (Electron Microscopy Science) 1X PBS (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Daisuke Tone, et al.,
bioRxiv - Neuroscience 2021
Quote:
... or 3.3 mM (Figure 5-figure supplement 1 and 8) ATP and 5 µM ProfilerPro Kinase Peptide Substrate 11 5-FAM-KKLNRTLSVA-COOH (PerkinElmer, U.S.A.), in the presence or absence of 0.66 µM CaM (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Yeon Soo Kim, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...
-
No products found
because this supplier's products are not listed.
Ying-Chao Hsueh, et al.,
bioRxiv - Immunology 2022
Quote:
... 5 ug/ml Brefeldin A was supplemented 4 hrs before subsequent Fc blocking (2.4G2, BioXCell), surface antibody staining ...
-
No products found
because this supplier's products are not listed.
Sarah J Kitson, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and FcR blocking reagent (Miltenyi Biotec, dilution 1:5) or isotype control antibody (mouse IgG1 ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Ismail Dahmani, Kai Ludwig, Salvatore Chiantia,
bioRxiv - Biophysics 2019
Quote:
... 2-(4-(3-(4-acetyl-3-hydroxy-2-propylphenoxy) propoxy) phenoxy acetic acid (PHE) was purchased from Cayman Chemical (Ann Arbor, MI, USA). 10-fold concentrated phosphate buffer (PBS ...
-
No products found
because this supplier's products are not listed.
Dorothea O Tilley, et al.,
bioRxiv - Immunology 2021
Quote:
Immunising and screening peptides are outlined in S.Table 2 (Figure 3-figure supplement 2) and were synthesized by Eurogentec (Belgium). A portion was further conjugated to Key Lymphocyte Haemoglutinin (KLH ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Elena A. May, et al.,
bioRxiv - Cell Biology 2020
Quote:
... After blocking in 5% milk or Intercept® (TBS) Protein-Free Blocking Buffer (LI-COR) and specific antibody decoration ...
-
No products found
because this supplier's products are not listed.
Lulu Huang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... BMP-2/4) (ERB medium)3 or adding 10 ng/ml human IL-22 (Peprotech) in WENRA4 (Wnt/ R-spondin1 ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Hongwen Chen, et al.,
bioRxiv - Biophysics 2023
Quote:
... and the complex was eluted with 5 CVs of 3×Flag peptide (0.1 mg/ml; ApexBio). The eluted protein was further purified by gel filtration using a Superose 6 Increase 10/300 GL column (Cytiva ...
-
No products found
because this supplier's products are not listed.
Renée M. van der Sluis, et al.,
bioRxiv - Immunology 2021
Quote:
... cells were seeded at 2–3 × 10~4 cells on 6.5 mm Transwell membranes (Corning) coated with 30 μg/mL Bovine type I collagen solution and cultured in 2x P/S (200 U/mL Pen/Strep DMEM-low glycose (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Rouhollah Habibey, et al.,
bioRxiv - Bioengineering 2023
Quote:
... SU- 8 5 and SU-8 50 (MicroChem) were subsequently spin-coated on the wafer at different heights (5 µm for microchannels and 100 µm for microwells ...
-
No products found
because this supplier's products are not listed.
Han Zhu, et al.,
bioRxiv - Cell Biology 2022
Quote:
Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
No products found
because this supplier's products are not listed.
N. Sumru Bayin, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Image stacks were obtained every 3-4 minutes for 6-8 hours using a LSM880 (Leica) with an environmental chamber (37°C with 5% CO2) ...
-
No products found
because this supplier's products are not listed.
Maria E. Candela, et al.,
bioRxiv - Immunology 2021
Quote:
Treatments with HBD3 peptide(s) was after 15-30 minutes 5 μg/ml of human β-Defensin-3 (hBD3) (Peptide Institute Inc., PeptaNova GmbH #4382-s), or 5 μg/ml of Linear Defensin (Almac Sciences Scotland Ltd ...