-
No products found
because this supplier's products are not listed.
Nora Schmidt, et al.,
bioRxiv - Microbiology 2020
Quote:
... and quantified with the LightMix Assay SARS-CoV-2 RdRP RTqPCR assay kit (TIB MOLBIOL, Germany) and the RNA Process Control kit (Roche) ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
Sandwich ELISA for quantitative detection of Human Caspase 3 concentrations.
Cat# CEK1828,
96T USD $400.0
Ask
Stephanie Torrino, et al.,
bioRxiv - Cell Biology 2020
Quote:
According to the manufacturer instructions (Glutaminase Microplate Assay Kit, Cohesion Biosciences), flash frozen tissue (0.1g/sample ...
-
No products found
because this supplier's products are not listed.
Daisuke Shimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
... using Mouse Mitochondrial DNA Copy Number Assay kit (Detroit R&D, Detroit, MI) for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio ...
-
No products found
because this supplier's products are not listed.
Shisu Zhao, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Cell counting kit 8 (CCK8) experiment for cell viability assay were performed using the CCK8 Kit (TargetMol, MA, USA). After a treatment ...
-
No products found
because this supplier's products are not listed.
S. Gulberk Ozcebe, et al.,
bioRxiv - Bioengineering 2020
Quote:
... ROS levels in the culture were determined via Mitochondrial ROS Activity Assay Kit (eEnzyme). Briefly ...
-
No products found
because this supplier's products are not listed.
Eva Jarc Jovičić, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 500 nM BHT and IS (8 pmol 18:3/18:3/18:3 triacylglycerol, 14:0/14:0 phosphatidylcholine, Larodan, Solna ...
-
No products found
because this supplier's products are not listed.
Ross D Overacker, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Inhibition of HIV-1 integrase was assessed using an HIV-1 integrase assay kit (XpressBio Life Science Products) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Alexandria P Eiken, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Cell viability and apoptosis were measured using Annexin V-FITC/propidium iodide (PI) assay kit (Leinco Technologies; Fenton, MO) per manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Tayler D. Sheahan, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3 µM (Adooq Bioscience A18250); oxytocin ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Dirk Hart, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Secreted AMH in cell culture supernatants was assessed using a microplate Enzyme-linked Immunosorbent Assay (ELISA) kit (ABIN6574075, Antibodies-Online GmbH) and performed according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Shouka Parvin Nejad, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The insoluble elastin content of oxalic acid digested samples was measured using the FastinTM Elastin Assay Kit by Biocolor (Accurate Chemical and Scientific Corporation ...
-
No products found
because this supplier's products are not listed.
Kiryu K. Yap, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human coagulation factor VIII levels in the mouse plasma were measured using a factor VIII enzyme-linked immunosorbent assay (ELISA) kit (Affinity Biologicals), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Itamar Harel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... equipped with 3 emCCDs (Evolve, Photometrics Inc.) using an Olympus UPlanApo 100x (NA 1.40 ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Kylie M. Konrath, et al.,
bioRxiv - Immunology 2021
Quote:
... and 6μg pNL4-3.luc.R-E- backbone (Aldevron) and incubated for 48 hours ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 ng/mL mrIL-3 (Gemini bio-products), and 10 ng/mL mrIL-6 (Gemini bio-products) ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Iris E. Glykofridis, et al.,
bioRxiv - Genetics 2022
Quote:
... Ab #3 (1:1000 in BSA, HPA028760, Atlas antibodies) and Ab #4 (1:1000 in BSA ...
-
No products found
because this supplier's products are not listed.
Jaqueline S. Generoso, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit polyclonal anti-capsule serotype 3 antiserum (SSI Diagnostica) followed by Alexa Fluor 594 goat anti-rabbit (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Tomoya Niinae, Yasushi Ishihama,
bioRxiv - Biochemistry 2023
Quote:
... A coupling system using 1-((Dimethylamino)(dimethyliminio)methyl)-1H-[1,2,3]triazolo[4,5- b]pyridine 3-oxide hexafluorophosphate/N,N-diisopropylethylamine was employed for the introduction of F2Pmp (PEPTIDE INSTITUTE, INC., Osaka, Japan) and a coupling system using 1-hydroxybenzotriazole/2-(1H-Benzotriazole-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphat/N,N-diisopropylethylamine was employed for the introduction of all other amino acids and a biotin PEG2 acid (Broad Pharm ...
-
No products found
because this supplier's products are not listed.
James T. McKenna, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#7001KH, Point Style 3, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Jessica P. Kuppan, et al.,
bioRxiv - Microbiology 2021
Quote:
C1 binding assays were performed using purified C1 (Complement Technologies A098) in the absence of other serum proteins and the presence of defined mAbs ...
-
No products found
because this supplier's products are not listed.
Qixiang He, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The virus titers were measured by flow cytometry assay (Expression Systems).
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Bence Kӧvér, et al.,
bioRxiv - Genetics 2023
Quote:
... Both assays take advantage of the RoToR HDA colony-pinning robot (Singer Instruments), which can pin out yeast on agar plates in a 96-well arrangement ...
-
No products found
because this supplier's products are not listed.
Mahmoud Suliman, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Dialysis was performed against deionized water using Spectra/Por 3 dialysis membrane tubing (Repligen) with a MWCO of 3.5 kDa for 48 hours ...
-
No products found
because this supplier's products are not listed.
Laura E. de Vries, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 3-5% human blood type O red blood cells (RBCs) (Sanquin, the Netherlands) at 37°C in 3% O2 ...
-
No products found
because this supplier's products are not listed.
Xusheng Qiu, et al.,
bioRxiv - Microbiology 2020
Quote:
... Mouse anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) monoclonal antibody was purchased from Meridian Life Science. Horseradish peroxidase (HRP)-conjugated anti-human ...
-
No products found
because this supplier's products are not listed.
Lucy Chou-Zheng, Asma Hatoum-Aslan,
bioRxiv - Microbiology 2019
Quote:
... The most concentrated fractions (3 ml total) were pooled and mixed with SUMO Protease (MCLAB, CA, USA) and provided SUMO buffer (salt-free) ...
-
No products found
because this supplier's products are not listed.
Alison Gallet, et al.,
bioRxiv - Microbiology 2021
Quote:
... aeruginosa-containing treatments and quantified using enzyme-linked immunosorbent assay (ELISA) analyses (Microcystins-ADDA SAES ELISA, Eurofins Abraxis). Each sample was analysed in duplicates and MC concentrations were determined according to the MC-LR response standard curve.
-
No products found
because this supplier's products are not listed.
Amit Rahi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... followed by incubation for 5 min and intermittent washing with 3 chamber volumes of buffer B: PLL PEG biotin (0.1 mg ml-1, Susos, AG), Streptavidin (0.625 mg ml-1 ...
-
No products found
because this supplier's products are not listed.
Maia Moog, Scott C. Baraban,
bioRxiv - Neuroscience 2022
Quote:
... were amplified at a gain of 20x and filtered at 1 kHz (−3 dB; eight-pole Bessel; Cygnus Technology, Inc.), digitized at 10 kHz using a Digidata 1320 A/D interface (Molecular Devices ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
Daniel D. Lam, et al.,
bioRxiv - Genetics 2021
Quote:
GABAergic neurons and glutamatergic neurons (iCell GABANeurons Kit and iCell GlutaNeurons Kit) were purchased from Cellular Dynamics. iCell GABANeurons and GlutaNeurons are highly pure populations of human neurons ...
-
No products found
because this supplier's products are not listed.
Marina Johnson, et al.,
bioRxiv - Immunology 2020
Quote:
... ClinicalTrials.gov Identifier: NCT04380896) who tested positive in a commercial screening assay for anti-Nucleocapsid IgG (Epitope Diagnostics Inc, San Diego, USA) (iii ...
-
No products found
because this supplier's products are not listed.
Jeremy Rich, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... visualized using the polink anti rat kit (GBI Labs) and the peroxidase/diaminobenzidine Rabbit PowerVision kit (ImmunoVision Technologies) ...
-
No products found
because this supplier's products are not listed.
Shoupeng Wei, et al.,
bioRxiv - Neuroscience 2023
Quote:
Hito Golgi-Cox Kit (Hitobiotec Corp., Wilmington, DE, USA) was used to reveal the structure and density of dendritic spines in the mPFC37–39 ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interferon Gamma (IFNg) ELISA Kit (RD-IFNg-Mu, Reddot biotech), Mouse Interleukin 6 (IL6 ...