-
No products found
because this supplier's products are not listed.
Miwa Umebayashi, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Methyl beta cyclodextrin was purchased from CycloLab. Cholesterol-water soluble ...
-
No products found
because this supplier's products are not listed.
Máire E Doyle, et al.,
bioRxiv - Pathology 2021
Quote:
... Type # SR5603 (Roboz Surgical Instrument Co ...
-
No products found
because this supplier's products are not listed.
Eline Berends, et al.,
bioRxiv - Neuroscience 2023
Quote:
Within the PIMSoft software (Version 1.11.0.22471 Beta, PeriMed, Järfälla, Sweden) regions of interest were placed on the barrel cortex on both the left and right hemisphere (10mm2) ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... magnetic beads were conjugated with monoclonal capture antibodies (mAB47:3, UmanDiagnostics), incubated with diluted mouse serum (1:8 or 1:16 dilution ...
-
No products found
because this supplier's products are not listed.
Ana Paula Zen Petisco Fiore, et al.,
bioRxiv - Cell Biology 2021
Quote:
... neddylation or proteasome activity were achieved by treating cells with 2.5 μM MLN4924 (Cayman Biochemicals # 15217) or 5 μM MG132 (Peptides International # IZL-3175-v) for the durations indicated in the figure legends ...
-
No products found
because this supplier's products are not listed.
Nila C Wu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Both cell types were maintained in IMDM (Wisent Bioproducts) supplemented with 10% FBS and 1% penicillin/streptomycin solution in plastic culture flasks ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Enrica Saponara, et al.,
bioRxiv - Physiology 2021
Quote:
... L-Type Triglycerol M (Wako Diagnostics, Enzyme Color R1 & R2), 96-well ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1002,
Inquiry
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Andrew I. Wong, et al.,
bioRxiv - Microbiology 2022
Quote:
... samples were separated on a Cogent Diamond Hydride Type C column (Microsolv Technologies). The mobile phase consisted of solvent A (ddH2O with 0.2% formic acid ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Mirjana Grujic, et al.,
bioRxiv - Immunology 2022
Quote:
... and 3 µl Draq7 (Biostatus, Shepshed Leicestershire ...
-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Yongle Chen, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... were pretreated by overnight incubation at 37°C with a 10 µL mixture of 5 ng/µL dodecyl-beta-D-maltoside (DDM, J&K Scientific, China) and 1 ng/µL trypsin (Promega ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... and for C-terminal cross-linked telopeptides of type I collagen (CTX-I, RatLaps, AC-06F1, Immunodiagnostics) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 ng/mL mrIL-3 (Gemini bio-products), and 10 ng/mL mrIL-6 (Gemini bio-products) ...
-
No products found
because this supplier's products are not listed.
Ugo Dionne, et al.,
bioRxiv - Systems Biology 2020
Quote:
... prey strains are each expressing a gene of interest fused at its 3’ end to the DHFR F[3] and are resistant to hygromycin B (HPH 250 μg/ml, Bioshop Canada). The same BY4741 strains were used in the growth assays with the addition of knockout (KO ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
Cat# MRNA14-20,
20µg, USD $168.00/20µg
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Yuanyuan Liu, et al.,
bioRxiv - Microbiology 2021
Quote:
... then cells were subcultured in 5 mL of SACC (23 AA + glucose) at a starting OD of 0.01 in butyl rubber stoppered anaerobic Balch-type tubes (ChemGlass). Cultures were incubated outside of the anaerobic chamber in a water bath set to 37 °C ...
-
No products found
because this supplier's products are not listed.
James T. McKenna, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#7001KH, Point Style 3, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Jean-Marc Aury, et al.,
bioRxiv - Genomics 2022
Quote:
... 3’-adenylated and Illumina adapters (Bioo Scientific, Austin, TX, USA) were then added using the Kapa Hyper Prep Kit (KapaBiosystems ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Paulus Mrass, et al.,
bioRxiv - Immunology 2022
Quote:
... We used the following antibodies: H3N2 virion antibody (ViroStat, Cat#: 1317); anti-mouse CD107A ...
-
No products found
because this supplier's products are not listed.
Marvin Thielert, et al.,
bioRxiv - Systems Biology 2022
Quote:
... Lys-N (ImmunoPrecise Antibodies) was added to the lysate in a 1:100 (enzyme/protein ...
-
No products found
because this supplier's products are not listed.
Dalia Rosano, et al.,
bioRxiv - Cancer Biology 2021
Quote:
CloneTracker XP 10M Barcode-3’ Library with RFP-Puro (BCXP10M3RP-P) was purchased from Cellecta. Production of lentiviral particles and MCF7 transduction was performed following CloneTracker™ XP Lentiviral Expressed Barcode Libraries online manual (https://manuals.cellecta.com/clonetracker-xp-lentiviral-barcode-libraries/) ...
-
No products found
because this supplier's products are not listed.
Avais M. Daulat, et al.,
bioRxiv - Cell Biology 2021
Quote:
... CLASP2 antibody was obtained from Absea Biotechnology ltd ...
-
Cat# F105,
3/pack, USD $939.00/Pack
Ask
Bocheng Yin, et al.,
bioRxiv - Biochemistry 2019
Quote:
... The stock solution of 0.5 M biotin-dPEG®3-benzophenone (biotin-BP, 10267, Quanta BioDesign) in anhydrous DMSO (89139-666 ...
-
No products found
because this supplier's products are not listed.
Huilei Wang, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Collagen IV polyclonal antibody (Assay Biotech, C0157), GAPDH mouse monoclonal (Novus Bio ...
-
No products found
because this supplier's products are not listed.
Tongtong Li, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and FLAG antibody (Zen-Bio, Chengdu, China) were used to detect the proteins.
-
No products found
because this supplier's products are not listed.
Priya Katyal, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Anti-Atsttrin antibody was supplied by Lampire Biological Laboratories (Pipersville ...
-
Rabbit polyclonal antibody to PSMB3
Cat# CQA5607,
200 ul USD $350.0, 100 ul USD $220.0, 50 ul USD $150.0
Ask
Rafał Zdrzałek, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Respective primary HRP-conjugated antibodies (α-FLAG: Cohesion Biosciences, CPA9020 ...
-
No products found
because this supplier's products are not listed.
Roie Cohen, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Samples were then incubated overnight at 4°C in the appropriate primary antibody diluted in antibody diluent buffer (GBI labs cat: E09-300). Following 3 washes in PBS ...
-
No products found
because this supplier's products are not listed.
R Barbieri, et al.,
bioRxiv - Microbiology 2020
Quote:
... the paraffin sections were incubated with anti-glycophorin A antibody JC 159 (Mouse Monoclonal Antibody, ref: Mob 066-05, Diagnostic BioSystems, Nanterre, France) at a 1/500 dilution using a Ventana Benchmark autostainer (Ventana Medical Systems ...
-
No products found
because this supplier's products are not listed.
Han-Wei Shih, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Alexa 647-conjugated anti-CWP1 antibody (Waterborne, New Orleans, LA) was used at 1:2,000 ...
-
No products found
because this supplier's products are not listed.
Nana Naetar, et al.,
bioRxiv - Cell Biology 2020
Quote:
... cells were stained with an anti-mEos2 antibody (Badrilla, Leeds, UK) following the standard IF protocol.
-
No products found
because this supplier's products are not listed.
Chiara E. Geyer, et al.,
bioRxiv - Immunology 2022
Quote:
... IL-6 concentration was determined using antibody pairs from U-CyTech Biosciences (Human IL-6 ELISA ...
-
No products found
because this supplier's products are not listed.
Ludmila Recoules, et al.,
bioRxiv - Genomics 2021
Quote:
... Rabbit anti- mH2A1.1 antibody was generated according to immunization protocol from Agro-Bio - La fierté Saint-Aubin – France ...
-
No products found
because this supplier's products are not listed.
Xi Chen, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Liver slides were stained with goat-anti-hFIX antibody (1:2000, Affinity Biologicals, GAFIX-AP). Subsequently ...