-
No products found
because this supplier's products are not listed.
Junji Itou, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... E2 concentration was measured by using E2 ELISA(EIA) kit (Calbiotech, ES180S-100, El Cajon, CA, USA). The animal experiments were approved by the Animal Research Committee of Kyoto University ...
-
Prostaglandin ( PGE2 ) Multi-Format ELISA / assay Kit
Cat# K051-H5,
1.0 ea, USD $1375.0
Ask
Azure D. Grant, et al.,
bioRxiv - Physiology 2021
Quote:
A commercially available fE2 enzyme-linked immunosorbent assay (ELISA) kit was used to quantify E2 in fecal samples (Arbor Assays, Ann Arbor, MI). These assays have been previously published in species ranging from rats and mice(130–132) ...
-
No products found
because this supplier's products are not listed.
Lannah S. Abasi, et al.,
bioRxiv - Biophysics 2023
Quote:
... Samples (5 µL) were placed in a µ-Slide 18-well glass bottom multi-well plate (Ibidi) for imaging and were allowed to settle for 5-10 minutes ...
-
No products found
because this supplier's products are not listed.
Kazuhiro Hayashi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... ELISA kits (Mouse BDNF ELISA Kit PicoKine™ EK0309)(Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Ghanem El Kassem, et al.,
bioRxiv - Systems Biology 2024
Quote:
... sgRNA template sequences of the format: 5′-GGAGAACCACCTTGTTGG-(N)20-GTTTAAGAGCTAAGCTGGAAAC-3′ were synthesized in a pooled format on microarray surfaces (GenScript Biotech, Inc.). Oligo pools were PCR-amplified using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Davide De Forni, et al.,
bioRxiv - Microbiology 2021
Quote:
... and an ELISA assay (SARS-CoV-2 Nucleocapsid Detection ELISA Kit, Sino Biological) was performed to measure produced virus through the quantification of the viral NP nucleoprotein (a measure of viral replication capacity).
-
No products found
because this supplier's products are not listed.
Xiangyu Gong, et al.,
bioRxiv - Bioengineering 2023
Quote:
High cell density (4×107 cells/mL) hPSC strips containing 1.5mg/mL collagen with 5% Geltrex were collected in an Anti-Adherence Rinsing Solution (STEMCELL Technologies) treated 60mm Petri dish ...
-
No products found
because this supplier's products are not listed.
Morgan L. Pimm, et al.,
bioRxiv - Cell Biology 2024
Quote:
... multi-wavelength TIRF microscopy (Nikon) was performed with 1 µM actin (10% Alexa-647 label ...
-
No products found
because this supplier's products are not listed.
Johannes Holert, et al.,
bioRxiv - Microbiology 2019
Quote:
... semi-quantitative ammonium test strips (Quantofix®, Macherey-Nagel, Germany) were used for instant ammonium quantification.
-
No products found
because this supplier's products are not listed.
Bhavani S Sahu, et al.,
bioRxiv - Physiology 2023
Quote:
... 5) ABC kit (Vector Labs); and 6 ...
-
No products found
because this supplier's products are not listed.
Tzyy-Chyn Deng, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 5 µl was transformed into chemically competent TAM-1 cells in a 96-well plate format (Active Motif #11096) and selected for Chloramphenicol resistance ...
-
No products found
because this supplier's products are not listed.
Michael T.S. Girling, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
The MethylFlash Global DNA Methylation (5-mC) ELISA Easy Kit (Epigentek, USA), utilising a colourimetric assay ...
-
No products found
because this supplier's products are not listed.
Jack Polmear, et al.,
bioRxiv - Immunology 2023
Quote:
96-well high-binding ELISA plates (Sarstedt) were coated overnight at 4°C with either goat anti-mouse IgA ...
-
No products found
because this supplier's products are not listed.
Eduardo A. González-Solares, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... HDF5 (Hierarchical Data Format) and CZI (Carl Zeiss Imaging format). This file format fragmentation is a real issue ...
-
No products found
because this supplier's products are not listed.
Maria T. Bejar, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The area was further sutured using steri-strip wound closure strips (3M) and covered with Tegaderm dressing film (3M ...
-
No products found
because this supplier's products are not listed.
Joseph Hiatt, et al.,
bioRxiv - Genetics 2020
Quote:
Cells were lysed in plate format in 50µL QuickExtract DNA Extraction Solution (Lucigen QE09050). Crude lysate was then incubated at 65°C for 20 minutes and 95°C for 20 minutes ...
-
No products found
because this supplier's products are not listed.
Qingwen Qian, et al.,
bioRxiv - Physiology 2022
Quote:
... were measured using commercially available ELISA kits (TSH ELISA kit, G-Biosciences, Cat No. IT6045; free T3 ELISA kit, G-Biosciences, Cat No. IT5691; T4 ELISA kit, G-Biosciences, Cat No ...
-
No products found
because this supplier's products are not listed.
Vani Narayanan, et al.,
bioRxiv - Biophysics 2022
Quote:
The RhoA Activation Assay Biochem Kit (bead pull-down format, Cytoskeleton) was used for performing the pull-down assay on 2D monolayers that were either uninduced or induced for the (DN ...
-
No products found
because this supplier's products are not listed.
Megan E. Honeywell, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Centrifugation through a 0.2 μm multi-well filter plate (Pall Laboratory, #5053) was used to remove DNA from the lysates ...
-
No products found
because this supplier's products are not listed.
Alana Rezende Godoi, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... The ELISA kit: testosterone (Elabscience Biotechnology Co. ...
-
No products found
because this supplier's products are not listed.
Ross Peterson, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
A Sandwich ELISA (Bovine Lactoferrin ELISA kit, NBP3-12185, Novus Biologicals) was used and adopted to determine bovine lactoferrin concentrations in rat serum ...
-
No products found
because this supplier's products are not listed.
Samuel C. Eisenberg, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Colorimetric Format (Cell Biolabs, CBA-110). The Cell Stain Solution (Part No ...
-
No products found
because this supplier's products are not listed.
Kehinde Adebayo Babatunde, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and irreversibly bonded them to a glass-bottom multi-well plate (MatTek Co., Ashland, MA).
-
No products found
because this supplier's products are not listed.
Dambarudhar SS Hembram, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and UBC9 (SUMO-E2) constructs were obtained from Addgene. Chk2-FHA plasmid was a gift from Ashok Venkitaraman (MRC) ...
-
No products found
because this supplier's products are not listed.
Atsushi Sugimoto, et al.,
bioRxiv - Microbiology 2022
Quote:
ELISA Kit (41135-1, PBL Assay Science, USA) and the Human IL-29/IL-28B (IFNλ1/3 ...
-
No products found
because this supplier's products are not listed.
Rebecca K. Lau, et al.,
bioRxiv - Biochemistry 2019
Quote:
... coli NucC bound to 5’-pApA or cAAA in hanging drop format by mixing protein (8-10 mg/mL) in crystallization buffer plus 0.1 mM 5’-pApA (Invivogen) or cAAA 1:1 with well solution containing 17-24% PEG 3350 ...
-
No products found
because this supplier's products are not listed.
Koki Yoshimoto, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human HGF Quantikine ELISA (R&D, DHG00B) and Human MMP-9 Sandwich ELISA Kit (Proteintech, KE00164) were used for cell culture supernatants according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jonathan Enders, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Blood ketones were measured using a hand-held blood monitor and β-hydroxybutyrate blood ketone strips (β-Ketone blood test strips, Abbott Laboratories ...
-
No products found
because this supplier's products are not listed.
Shuowu Liu, et al.,
bioRxiv - Immunology 2019
Quote:
... we pre-coated 96-well multi-screen plates with 1 μg/ml goat anti-mouse IgG (Southern Biotech) or 20 μg/ml poly-L-lysine (Sigma ...
-
No products found
because this supplier's products are not listed.
Kelsey Voss, et al.,
bioRxiv - Immunology 2021
Quote:
Autoantibodies were measured with ELISA kits purchased from Alpha Diagnostics: Anti-Histone Total Ig ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... RANKL and insulin were measured by mouse Osteocalcin ELISA Kit (BioVision), OPG ELISA Kit (Boster Biological Technology) ...
-
No products found
because this supplier's products are not listed.
David Camerini, et al.,
bioRxiv - Immunology 2023
Quote:
... ELISA plates were coated overnight with rabbit anti human Fc gamma chain-specific antibody (Jackson ImmunoResearch). Plates were then washed with DPBS ...
-
No products found
because this supplier's products are not listed.
Emanuele Lettera, et al.,
bioRxiv - Cell Biology 2023
Quote:
Multi-test slides (10 well, MP Biomedicals) were treated for 20’ with Poly-L-lysine solution (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Maria-Daniela Cirnaru, et al.,
bioRxiv - Neuroscience 2020
Quote:
... RT-PCR reactions were set up in a 384-well format using 2X SensiFAST Probe No-ROX Kit (Bioline, BIO-86005) and 1 µl of cDNA per reaction in a total volume of 10 µl ...
-
No products found
because this supplier's products are not listed.
Jong-suk Mo, et al.,
bioRxiv - Microbiology 2022
Quote:
... and shown to be seronegative to IAV antibodies by a commercial ELISA kit (AI MultiS-Screen kit, IDEXX, Westbrook, ME). Pigs were divided into six groups ...
-
No products found
because this supplier's products are not listed.
Hyunjun Yang, Adam G. Kreutzer, James S. Nowick,
bioRxiv - Microbiology 2023
Quote:
... Suitable crystallization conditions were identified by screening experiments in a 96-well plate format with the aid of using screening kits from Hampton Research (including PEG/Ion ...
-
No products found
because this supplier's products are not listed.
Ziyi Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Add 100 μL Working Biotin Conjugate Antibody (Rat IL-6 ELISA Kit, RK00020; Rat IL-1β ELISA Kit, RK00009; Rat IL-10 ELISA Kit, RK00050, Abclonal, China) in each well ...
-
No products found
because this supplier's products are not listed.
Shivani N. Mann, et al.,
bioRxiv - Physiology 2020
Quote:
... 17α-E2 powder (Steraloids, Newport, RI) was dissolved in DMSO at a concentration of 10mg/ml and stored at −80°C ...
-
No products found
because this supplier's products are not listed.
Maximilian Bunz, et al.,
bioRxiv - Microbiology 2023
Quote:
Live cell imaging was performed in a 96-well format using an Incucyte plate imager (Sartorius). Images were taken every 2-4 h in the respective channels ...
-
No products found
because this supplier's products are not listed.
Rebecca S. Hofford, et al.,
bioRxiv - Neuroscience 2020
Quote:
A morphine ELISA kit (Abnova #KA0935) was used to quantify morphine in serum and DStr ...
-
No products found
because this supplier's products are not listed.
Zhiqing Huang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Enzyme-linked immunosorbent assays (ELISA) using the human POSTN ELISA kit from Aviva Systems (Cat # OKCD09048 ...
-
No products found
because this supplier's products are not listed.
Yuji Matsumoto, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
The phosphorylated neurofilament H ELISA kit (BioVendor Laboratorni Medicina AS ...
-
No products found
because this supplier's products are not listed.
Hassan Nassour, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... The IP-One ELISA assay kit from CisBio Bioassays ...
-
No products found
because this supplier's products are not listed.
Tom Biton, et al.,
bioRxiv - Cell Biology 2023
Quote:
... The block edges were covered with additional strips of carbon tape and 2-4 strips of copper tape (EMS; cat#77802) and coated with a layer of colloidal silver liquid (EMS ...
-
No products found
because this supplier's products are not listed.
Sara M. Blazejewski, et al.,
bioRxiv - Neuroscience 2020
Quote:
... were pulled to tip resistances of 5-8 M Ώ using a multi-stage puller (Sutter Instruments) and were filled with K-gluconate based intracellular solution ...
-
No products found
because this supplier's products are not listed.
Katherine A. Easterling, et al.,
bioRxiv - Plant Biology 2020
Quote:
... The 1,121 individual original format FASTA sequences (PacBio reads) are available in a supplemental file (Supplementary Material 2).
-
No products found
because this supplier's products are not listed.
Lisandra Vila Ellis, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... the strips were mounted on slides using Aquamount (18606, Polysciences) with the flat side facing the coverslip ...
-
No products found
because this supplier's products are not listed.
Liu Ruizhe, et al.,
bioRxiv - Zoology 2023
Quote:
Genomic DNA of the strain E2 was extracted using a TIANamp Bacterial DNA Kit according to the manufacturer’s protocol (Tiangen Biotech Co., LTD, Beijing, China). The PacBio and Illumina Miseq sequencing of the strain E2 genome and bioinformatic analysis were performed by Guangdong Magigene Biotechnology Co. ...
-
No products found
because this supplier's products are not listed.
John Lees, et al.,
bioRxiv - Molecular Biology 2023
Quote:
MeDIP-Seq libraries for Ion Torrent semiconductor sequencing were performed on the Ion Torrent PGM using a modified protocol from Ion Plus Fragment Library kit (Catalog # 4471252) combined with a 5-hydroxymethylcytosine (5hmC Kit, Catalog # AF-110–0016) immunoprecipitation kit (Diagenode) according to a previously optimized protocol (Guerrero-Bosagna & Jensen ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...